অধ্যায়-১

বিশ্বগ্রাম (Global Village)


বিশ্বগ্রাম (Global Village)। বিশ্বগ্রাম এর প্রবর্তক মার্শাল ম্যাকলুহ্যান (জুলাই ২১, ১৯১১ – ডিসেম্বর ৩১, ১৯৮০)। কানাডিয়ান দার্শনিক হার্ভার্ট মার্শাল ম্যাকলুহ্যান যোগাযোগ তত্বের জনক। তিনি সর্বগ্রথম তাঁর রচিত The Gutenberg Galaxy: The Making of Typographic Man (১৯৬২) বইয়ে বিশ্বগ্রামের ধারনা দেন। অতঃপর ১৯৬৪ সালে Understanding Media গ্রন্থে বিশ্বগ্রাম সম্পর্কে আরো বিস্তারিত বর্ণনা করেন।

গ্লোবাল ভিলেজ বা বিশ্বগ্রামের ধারণা নতুন নয়। দীর্ঘদিন ধরেই এই শব্দগুলো ব্যবহার করে আসছি সবাই। তবে সত্যিকারের গ্লোবাল ভিলেজ বা বিশ্বগ্রাম বোঁধহয় বলা যায় ইন্টারনেটের ভার্চুয়াল জগতটাকেই। দেশ, জাতি, ধর্ম, বর্ণ, বয়স নির্বিশেষে ইন্টারনেটের ভার্চুয়াল প্ল্যাটফর্মে যুক্ত এখন বিশ্বের এক-তৃতীয়াংশেরও বেশি মানুষ।

যেকোনো সময় সর্বশেষ খবরের জন্য রয়েছে অনলাইন পত্রিকা, খবর ছড়িয়ে দিতে রয়েছে ফেসবুক, টুইটার। যেকোনো তথ্যের জন্য রয়েছে গুগল। কেনাকাটা করতেও ই-কমার্সে অভ্যস্ত হয়ে উঠছে বিশ্বব্যাপী মানুষেরা। শিক্ষার জন্যও রয়েছে ইন্টারনেট, স্বা্েযর জন্যও রয়েছে ইন্টারনেট। সব মিলিয়ে ইন্টারনেট এখন জীবনের অন্যতম প্রধান অনুষঙ্গ।

সামাজিক যোগাযোগের ওয়েবসাইটগুলোর কল্যাণে গোটা বিশ্ব এখন অনেক বেশি কাছাকাছি চলে এসেছে। ফেসবুক, টুইটার, ফ্লিকার, ইন্সটাগ্রাম, পিনটারেস্ট, টাম্বলার, সাউন্ড ক্লাউড আর ইউটিউবের কল্যাণে গোটা বিশ্ব এখন পরিণত হয়েছে শেয়ারিংয়ের স্থানে। বিশেষ করে তরুণদের মধ্যে এসব সামাজিক যোগাযোগের ওয়েবসাইট এবং সার্ভিস পেয়েছে অসামান্য জনপ্রিয়তা।

বর্তমান সময়কে বলা হয়ে থাকে ‘বিশ্বায়নের সময়’। অত্যন্ত জোর দিয়েই বলা হচ্ছে, এ যুগ হলো দ্রুতগতিতে এগিয়ে চলার ‘বিশ্বায়নের যুগ’। আত্মতৃপ্তি সহকারে ঘোষণা করা হচ্ছে, সারা বিশ্ব এখন আমার-আপনার ঘরের মধ্যে। দুনিয়া হলো এক বিশ্বগ্রাম। ‘বিশ্বায়ন’ শব্দটির গভীরতা ও ব্যাপকতা অপরিসীম। গন্ডি-বদ্ধতা-সীমাবদ্ধতা-সংকীর্ণতাকে অতিক্রম করার মধ্য দিয়েই তো ঘটে সমাজের অগ্রগতি। ‘থাকবো নাকো বদ্ধ ঘরে; দেখবো এবার জগৎটাকে/কেমন করে ঘুরছে মানুষ যুগান্তরের ঘূর্ণিপাকে’- ছত্রটি শুধু কবির কল্পনা নয়। এ হলো মানুষের এগিয়ে চলার সহজাত আকাক্সক্ষা। একথা কেউই অস্বীকার করবে না যে, সংকীর্ণতার বিপ্রতীপে কমিউনিস্ট পার্টিই প্রথম আন্তর্জাতিকতার মতাদর্শ বিশ্বজনতার প্রাঙ্গণে তত্ত্বে এবং প্রয়োগে সুপ্রতিষ্ঠিত করেছে। ১৮৪৮ সালে প্রকাশিত কার্ল মার্কস ও ফ্রেডরিকে এঙ্গেলস রচিত ‘কমিউনিস্ট ইস্তাহার’ যে বাক্য দিয়ে সমাপ্ত হয়েছিল তা হলো- ‘দুনিয়ার মজদুর এক হও’। এর চেয়ে বড় ও ব্যাপক বিশ্বায়নের বার্তা আর কি হতে পারে? কার্যত রাজনৈতিক স্তরে এটাই ছিল প্রথম নতুন যুগ সৃষ্টির লক্ষ্যে বিশ্বায়নের বার্তা।

মার্কিন লেখক এলভিন টফলারের (১৯৮১) ‘তৃতীয় জোয়ার’ বা তথ্যনির্ভর সমাজব্যবস্থায় আমাদের বসবাস। তিনি বলেছেন, সভ্যতাগুলোর তিনটি প্রধান জোয়ার বা বৈশিষ্ট্য আছে। কৃষিকাজ ছিল সভ্যতার প্রথম জোয়ার, আর দ্বিতীয় জোয়ার গড়ে ওঠে শিল্পায়নের মাধ্যমে। টফলারের মতে, এই দুই জোয়ার ম্লান হয়ে আসছে এবং পৃথিবীর ভবিষ্যৎ গতিপথ স্পষ্ট হয়ে উঠেছে তৃতীয় জোয়ারের কারণে। এই তৃতীয় জোয়ার হলো ইলেকট্রনিক সভ্যতা বা তথ্য যুগ, যেটি পরিপূর্ণতা পেয়েছে ইন্টারনেটের বদৌলতে।  কানাডীয় চিন্তাবিদ ও যোগাযোগ বিশেষজ্ঞ মার্শাল ম্যাকলুহান (১৯৬৪) যে ‘গ্লোবাল ভিলেজ বা বিশ্বগ্রাম’ ধারণার কথা বলেছিলেন তার মূলনায়ক এখন ইন্টারনেট। আধুনিক সমাজে জুতা সেলাই থেকে চণ্ডিপাঠ পর্যন্ত সবকিছু যে তথ্যকে ঘিরে আবর্তিত হচ্ছে তার সবচেয়ে বড় শক্তি এখন ইন্টারনেট। এই ইন্টারনেটের উপর ভিত্তি করে তৈরি হয়েছে অনলাইন গণমাধ্যমের সুবৃহৎ পরিসর। সময়, স্থান ইত্যাদির চিরাচরিত প্রতিবন্ধকতাকে জয় করে তাৎক্ষণিকতার ভিত্তিতে প্রতিনিয়ত নির্মিত কিংবা বিনির্মিত হচ্ছে অনলাইন গণমাধ্যমের দর্শন।

প্রতিনিয়ত নতুন নতুন বৈশিষ্ট্য সন্নিবেশিত হওয়ায় অনলাইন গণমাধ্যমের সীমারেখা নির্ধারণ করা গণমাধ্যম চিন্তকদের জন্য কঠিন হয়ে পড়ছে। সনাতন গণমাধ্যমের বৈশিষ্ট্যগুলোকে ধারণ করেই প্রকৃতঅর্থে অনলাইন গণমাধ্যম তার পরিসর নির্মাণ করেছে। এ কারণে কোনো কোনো গণমাধ্যম-পণ্ডিত নয়া প্রযুক্তিনির্ভর এ মাধ্যমটিকে ‘ম্যাস মাল্টিমিডিয়া’ (McAdams, 2005) হিসেবে আখ্যায়িত করছেন। অর্থাৎ সংবাদপত্রের টেক্সট, ছবি কিংবা রেডিও’র শব্দ এবং টেলিভিশনের ভিডিও চিত্র সবকিছুই একইসাথে পাওয়া যাচ্ছে অনলাইন গণমাধ্যমে। আরো স্পষ্ট করে বললে, কোনো একটি সংবাদ সাইট থেকে অডিয়েন্স নির্দিষ্ট একটি সংবাদ যেমন পাঠ করতে পারেন একই সাথে পডকাস্টিং সুবিধার কারণে সেই সংক্রান্ত খবর শুনতে এবং ব্রডকাস্টিংয়ের মাধ্যমে তার ভিডিও ফুটেজ দেখতে পারেন। একটি মাধ্যমে সনাতন গণমাধ্যমগুলোর এমন সংমিশ্রণ সম্ভব করে তুলেছে অনলাইন প্রযুক্তি। এ যেন জন মিল্টন থেকে লক কিংবা ম্যাডিসন থেকে স্টুয়ার্ট মিলের বাক-স্বাধীনতার চরম বহিঃপ্রকাশ।

বিশ্বগ্রামের উপাদান অনেকগুলো, তারমধ্যে উল্লেখযোগ্য হলো-

  • যোগাযোগ
  • কর্মসংস্থান
  • শিক্ষা
  • চিকিৎসা
  • গবেষণা
  • অফিস
  • বাসস্থান
  • ব্যবসা-বানিজ্য
  • সংবাদ
  • বিনোদন ও সামাজিক যোগাযোগ
  • সাংস্কৃতিক বিনিময়

এছাড়াও আরো অনেক উপাদান রয়েছে বিশ্বগ্রামে। নিম্নে উপাদান সমূহের কিছু বর্ণনা দেয়া হলো-

যোগাযোগঃ বিশ্বগ্রামে যোগাযোগ হলো এর প্রধান উপাদান। যোগাযোগ মানে তথ্য আদান প্রদানের উপায়। মানুষ থেকে মানুষ বা যন্ত্র থেকে যন্ত্রে তথ্য আদান প্রদান হতে পারে। মাধ্যম-ও হতে পারে শব্দ, বিদ্যুৎ, তড়িৎচৌম্বক বিকিরণ (আলো বা রেডিও-ওয়েভ)।

তথ্য ও যোগাযোগ প্রযুক্তির মাধ্যমে দেশ-মহাদেশ, জাতি-বর্ণ নির্বিশেষে সকলের সাথে যোগাযোগ এতোটাই সহজ হয়েছে যে, মানুষে মানুষে যোগাযোগ করার জন্য এখন সু-দূর দেশে পারি দিতে হয় না। কেবল মাত্র একটি ফোন ডায়াল বা নেট ডায়ালের মাধ্যমেই সম্ভব হয় মূহুর্তের মধ্যেই।

যোগাযোগের মাধ্যমগুলো মানুষকে নিজ ভুবনকেন্দ্রিক ভাবনার তাড়না যোগাচ্ছে কিনা, তা নিয়ে একটা সন্দেহ-সংশয় বিশেষজ্ঞদের বেশ কিছুদিন যাবতই ছিল। আর সম্প্রতি এই সন্দেহের যথেষ্ট ভিত্তি আছে বলে জানান দিয়েছেন গবেষকরা। তাঁদের দাবি অনুসারে, একটা মানুষ কতখানি আত্মকেন্দ্রিক সেটা তার ফেসবুকের বন্ধু সংখ্যা এবং এর অন্যান্য ব্যবহার দেখে অনুমান করা সম্ভব। শুধু তাই না, ফেসবুক ব্যবহারকারীদের মাধ্যমে গ্রীক দেবতা নার্সিসাস আবার নতুনভাবে ফিরে আসছেন বলে বলেও মন্তব্য করেছেন ওয়েস্টার্ন ইলিনিয়স বিশ্ববিদ্যালয়ের এই গবেষকরা।

কর্মসংস্থানঃ তথ্যপ্রযুক্তি বিশেষত ইন্টারনেটের কল্যাণে বিশ্ব আজ আমাদের হাতের মুঠোয় চলে এসেছে। বাংলাদেশের প্রত্যন্ত অঞ্চলের কোনো গণমাধ্যমের খবর মুহুর্তেই ছড়িয়ে পড়ছে বিশ্বব্যাপী। তেমনি আমরাও বিভিন্ন দেশের বিভিন্ন স্থানের খবর পাচ্ছি। বিভিন্ন দেশ-মহাদেশের কর্মসংস্থানের সকল খবরাখবর পেয়ে যাই। অজ্ঞানতা, কু-সংস্কার, দূর করে মানুষের জীবনে সচেতনতা বৃদ্ধি করে শিক্ষা। তাই শিক্ষাই জীবনের আলোক ধারা হিসাবে বিবেচিত। প্রতি বৎসর ক্রমাগত পাসের হার বাড়ছে। এটি অবশ্যই ভাল দিক। কিন্তু এর সঙ্গে সঙ্গে শিক্ষার মান বাড়ছে কিনা সেটিও একটি প্রশ্ন হয়ে আছে। কেবল পাসের হার বাড়ছে ভাল কলেজে সুযোগ পাচ্ছে না। শিক্ষা জীবন শেষে ভাল চাকরির খোঁজ মিলছে না। শিক্ষিত যুবক বেকার কেন? কর্মসংস্থানের সুযোগের অভাব হয়তো বেকার। অনেকে আবার বি.এস.সি./বি. কম. পাস করে অফিসিয়াল চাকরি না পাওয়াতে বেকার বসে আছে এটা তার জীবনের দুর্বলতা। বাড়ছে জনসংখ্যা বাড়ছে শিক্ষার হার সেই পরিমাণ বাড়ছে না কর্মসংস্থান। তাই শিক্ষার হার বৃদ্ধির সাথে সাথে যোগ্যতা ভিত্তিক কর্মসংস্থানের সুযোগ সৃষ্টি করা খুব বেশি জরুরি। দেশে কর্মসংস্থানের বৃদ্ধির সাথে সাথে দেশের লোকের আর্থিক আয় বৃদ্ধি আয় এবং দেশ সমৃদ্ধি উন্নয়নের দিকে এগিয়ে। তাই শিক্ষিত লোক বেকার না রেখে কর্মসংস্থানের সুযোগ সৃষ্টির মাধ্যমে দেশ সমৃদ্ধির পথে এগিয়ে নিতে পারে। শিক্ষিত যুবকদের বেকারত্ব দূর করার জন্য কর্মসংস্থান সৃষ্টি করার একান্ত জরুরি, যা বিশ্বগ্রাম চ্যালেঞ্জ হিসেবে গ্রহন করতে পারে।

শিক্ষাঃ ইংরেজি ভাষায় শিক্ষার প্রতিশব্দ হলো Education. Education শব্দের সাধারণ আভিধানিক অর্থ হলো : শিক্ষাদান ও প্রতিপালন, শিক্ষাদান, শিক্ষ। Educate মানে : to bring up and instruct, to teach, to train অর্থাৎ প্রতিপালন করা ও শিক্ষিত করিয়া তোলা, শিক্ষা দেওয়া, অভ্যাস করানো।

বিজ্ঞানের ক্রম-অগ্রগতির এ সময়টিকে বিশ্বজুড়ে চিহ্নিত করা হচ্ছে তথ্য-প্রযুক্তির যুগ হিসেবে। বর্তমানে সামরিক বা পারমাণবিক শক্তি নয় তথ্য ও তথ্যপ্রযুক্তি ব্যবহারের সক্ষমতা দ্বারাই নির্ধারিত হচ্ছে দেশ বা রাষ্ট্রের ক্ষমতা। এক সময়ের সামরিক স্বার্থ ও অস্ত্র গবেষণার সীমাবদ্ধ গণ্ডি পেরিয়ে তথ্য-প্রযুক্তি এখন মানুষের একান্ত ব্যক্তিগত ড্রইং রুম বা বাসগৃহে প্রবেশ করেছে। রচলিত ধারায় শিক্ষা শিক্ষার্থীদের কাছে একটি কঠিন ও নিরস বিষয়। এ ধারায় পাঠ্যপুস্তকের বিষয়সমূহ শিক্ষকগণ শ্রেণীকক্ষে যেভাবে উপস্থাপন করেন তাতে শিক্ষার্থীরা পঠিত বিষয়ের প্রতি কিছুতেই আগ্রহী হয়ে উঠছে না। শিক্ষা-বিষয়ে শিক্ষার্থীদের মনোযোগ ধরে রাখা যাচ্ছে না এবং বিষয়বস্তু ঠিক মতো বোধগম্যও হচ্ছে না। তাই অধিকাংশ ক্ষেত্রে শিক্ষার্থীরা পঠিত বিষয়কে না বুঝেই আত্মস্থ করার চেষ্টা করছে। ফলে প্রকৃত শিখনফল অর্জিত হচ্ছে না। পরীক্ষায় ফল ভালো করলেও কর্মজীবনে গিয়ে অর্জিত শিক্ষাকে কাজে লাগাতে ব্যর্থ হচ্ছে। শিক্ষাক্ষেত্রে বিরাজিত এই সমস্যাকে দূর করার লক্ষ্যে ডিজি অর্থাৎ ডিজিটাল ক্লাসরুম একটি শুভ সূচনা। এতে শিক্ষা বিষয়টিকে শিক্ষার্থীর নিকট অনেক বেশি আনন্দময়, সহজবোধ্য করা যাবে। শিক্ষা হয়ে উঠবে শিক্ষার্থীকেন্দ্রিক।

শিক্ষার মানোন্নয়নে ‘শিক্ষকদের দ্বারা ডিজিটাল কন্টেন্ট তৈরি’ আরেকটি উল্লেখ করার মতো বিষয়। ডিজিটাল কনটেন্ট হলো পাঠ্যপুস্তকে বর্ণিত বিষয়কে শব্দে, ছবিতে ও গতিময়তায় উপস্থাপনের জন্য নির্মিত শিক্ষকদের তৈরি অডিও-ভিজ্যুয়াল উপকরণ। শিক্ষকগণ আগে থেকেই কম্পিউটারে পাওয়ার পয়েন্ট প্রোগ্রামে বিভিন্ন ভিডিও, অডিও, ইফেক্ট, এনিমেশন ব্যবহার করে পাঠ্যপুস্তকের কনটেন্টকে সøাইডে রূপান্তরিত করবেন। পরে শ্রেণীকক্ষে সেটি শিক্ষার্থীদের সামনে উপস্থাপন করবেন। এতে পাঠ্যপুস্তকের কালো অক্ষরে বর্ণিত ঘটনা বা বিষয় শিক্ষার্থীর কাছে শব্দে, চিত্রে, গতিময়তা, ভিডিও এবং এনিমেশনের মাধ্যমে সহজেই জীবন্ত ও হৃদয়গ্রাহী হয়ে উঠতে পারে। কনটেন্ট তৈরির জন্য এক জন শিক্ষকের কম্পিউটারের সাধারণ জ্ঞান, ইন্টারনেট থেকে ছবি, এনিমেশন বা ভিডিও ডাউনলোড করার কৌশল, তা পাওয়ারপয়েন্টে অন্তর্ভুক্ত করার দক্ষতা থাকলেই চলবে। শিক্ষকদের তৈরি ডিজিটাল কনটেন্ট একটি বিশেষ ওয়েব সাইট এবং জাতীয় ই-তথ্যকোষে সংরক্ষণ করা হচ্ছে। প্রত্যন্ত অঞ্চলের শিক্ষকগণ এ সব সাইট থেকে ডিজিটাল কনটেন্ট সংগ্রহ করে এমনকি প্রয়োজন অনুযায়ী সম্পাদনা করে শ্রেণীকক্ষে ব্যবহার করতে পারবেন। চাইলে শিক্ষার্থীরাও সেখান থেকে সাহায্য নিতে পারবে। বিশেষ করে বিজ্ঞান, গণিত, ব্যাকরণ এবং ইংরেজির মতো কঠিন বিষয়গুলো এ পদ্ধতিতে শিক্ষার্থীদের নিকট আরও বোধগম্য এবং সহজ করে উপস্থাপন করা যায়।

চিকিৎসাঃ তথ্য ও যোগাযোগ প্রযুক্তির উন্নতির ফলে চিকিৎসা শাস্র হয়ে গেছে এখন চিকিৎসা বিজ্ঞান। চিকিৎসা বিজ্ঞান বা চিকিৎসা শাস্ত্র হল রোগ উপশমের বিজ্ঞান কলা বা শৈলী। মানব শরীর এবং মানব স্বাস্থ্য ভালো রাখার উদ্দেশ্যে রোগ নিরাময় ও রোগ প্রতিষেধক বিষয়ে চিকিৎসা বিজ্ঞানে অধ্যায়ন করা হয় এবং প্রয়োজন অনুসারে বিভিন্ন পদ্ধতি ব্যবহার করা হয়। সমসাময়িক চিকিৎসা বিজ্ঞানে স্বাস্থ্য বিজ্ঞান অধ্যয়ন, গৱেষণা, এবং সংশ্লিষ্ট প্রযুক্তিবিদ্যার ব্যবহার করে লব্ধ জ্ঞানের মাধ্যমে ঔষধ বা শল্য চিকিৎসার দ্বারা রোগ নিরাময় করার চেষ্টা করা হয়।ঔষধ বা শল্য চিকিৎসা ছাড়াও মনোচিকিৎসা (psychotherapy), কৃত্রিম অঙ্গ সংস্থাপন, আনবিক রশ্মির প্রয়োগ, বিভিন্ন বাহ্যিক উপায় (যেমন, স্প্লিণ্ট (Splint) এবং ট্রাকশন),জৈবিক সামগ্রি (রক্ত, অণু জীব ইত্যাদি), শক্তি্র অন্যান্য উৎস (বিদ্যুৎ, চুম্বক, অতি-শব্দ ইত্যাদি) ইত্যাদিরও প্রয়োগ করা হয়।

অধুনিক চিকিৎসা বিজ্ঞানে বিশ্বগ্রামের ভুমিকা অনেক। ঘরে বসে নিন অনলাইন চিকিৎসা সেবা প্রধান করছে বিভিন্ন ডাক্তারগণ। দেশ থেকে বিদেশে আবার বিদেশ থেকে দেশে আবার দেশ থেকে দেশে এ সেবা প্রদান করা হয়। এতে বিশ্বগ্রামের ভূমিকাই পুরোটা।

গবেষণা গবেষণা (ইংরেজি: Research) হল মানুষের বুদ্ধিবৃত্তিক অনুসন্ধান প্রক্রিয়া এবং নতুন কিছু আবিষ্কারের নেশায় বিজ্ঞানীদের কার্যাবলী। যিনি গবেষণা করেন বা গবেষণা কর্মের সাথে জড়িত, তিনি গবেষক বা গবেষণাকারী নামে পরিচিত।

গবেষণা সাধারণত বালিঘড়ি মডেল-কাঠামোর ভিত্তিতে পরিচালিত হয়। এই মডেল-কাঠামো অনুসারে গবেষণা শুরু হয় একটি বিস্তৃত কাঠামোকে কেন্দ্র করে যেখানে নির্দিষ্ট প্রজেক্ট বা উদ্দেশ্যের আওতায় প্রয়োজনীয় তথ্য সংগ্রহের মাধ্যমে তথ্য বিশ্লেষণ, ফলাফল উপস্থাপন এবং প্রাসঙ্গিক আলোচনা সন্নিবেশিত করা হয়। গবেষণার প্রধান ধাপসমূহ হচ্ছে:

  • গবেষণার সমস্যা চিহ্নিতকরণ
  • প্রাসঙ্গিক গবেষণা ও তথ্য পর্যালোচনা
  • গবেষণার সমস্যা নির্দিষ্টকরণ
  • অনুমিত সিদ্ধান্ত গ্রহণ ও গবেষণার প্রশ্ন নির্দিষ্টকরণ
  • তথ্য সংগ্রহ
  • তথ্য বিশ্লেষণ ও বর্ণনাকরণ
  • প্রতিবেদন তৈরি

গবেষণার প্রতিটি ধাপেই তথ্য ও যোগাযোগ পদ্ভতির ব্যবহার করা উচিৎ। নচেৎ গবেষণা কার্যক্রম এগিয়ে নিয়ে যাওয়া সম্ভব নয়।

অফিসঃ অফিস ব্যবস্থাপনায় তথ্য-প্রযুক্তির ব্যবহার বর্তমানে পূর্বের সকল রেকর্ড ছাডিয়ে গেছে। বর্তমান অফিস ব্যবস্থাপনায় তথ্য প্রযুক্তির ব্যবহারের মাধ্যমে দেনন্দিন কাজকে আরো সহজ-সরল ও সাবলীল করে তুলেছে। বিশ্বগ্রামের ধারণা অফিস ব্যবস্থাকে করেছে আরো সমৃদ্ধ ও দক্ষ কার্য পরিধির ধারা।

বর্তমান অফিস ব্যবস্থাপনায় যুক্ত হয়েছে নতুন কিছু শব্দ, এর মধ্যে ই-গভর্নেন্স অন্যতম। ই-গভর্ণনেন্সের মাধ্যমে পরিচালিত হয়, রাষ্ট্রীয় পরিচালনাধীন অফিস ও স্বায়ত্বশাসিত অফিস সমূহ।তথ্য ও যোগাযোগ প্রযুক্তির অভূতপূর্ব উন্নয়েনর ফলে আমরা পেয়েছি সহজ ও বোধগম্যতা সম্পন্ন অফিস ব্যবস্থাপনা।

বাসস্থানঃ ব্রিটেনের ৪৩ শতাংশ মানুষ বাসস্থান সঙ্কটে ভুগছে। আর ধীরে ধীরে এ হার বেড়েই চলেছে। সেই সঙ্গে বাড়ছে ফুটপাথে মানুষের বসবাস। গত ২০১১ সালের ডিসেম্বরে গৃহহীন মানুষের হার ছিল ১৮ শতাংশ।সম্প্রতি বিভিন্ন সংস্থার জরিপে এসব তথ্য উঠে এসেছে।ব্রিটেনের অসংখ্য মানুষ প্রচণ্ড ঠাণ্ডার মধ্যেও রাস্তার পাশে ফুটপাথে আশ্রয় নেয়। সাম্প্রতিক জরিপে এ সংখ্যা ছয় হাজার বলে উল্লেখ করা হয়েছে।ইরানের আরবি ভাষার নিউজ চ্যানেল আল আলমের সঙ্গে এক সাক্ষাতকারে রাজনৈতিক বিশ্লেষক শাব্বির রাজাভি বলেন, “ব্রিটেনের রাস্তাঘাটে এত বিশাল সংখ্যক মানুষ আশ্রয় নেয়ার ঘটনায় প্রমাণিত হয়, দেশ পরিচালনায় নিয়োজিত ব্যক্তিরা কথা ও কাজে ন্যায়পরায়ণ নয়।”

বর্তমানে তথ্য ও যোগাযোগ প্রযুক্তি বাসস্তানকে করে তুলেছে অত্যাধুনিক স্বর্গবাসযোগ্য। যদি তথ্য প্রযুক্তির মাধ্যমে বাসস্থানকে সমৃদ্ধ করা যায়, তাহলে বিষয়টি কতইনা অধুনিক হয়! তথ্য ও যোগাযোগ প্রযু্ক্তির মাধ্যমে বাসস্থানের ব্যবস্থা বলতে, বাসস্থানকে তথ্য ও যোগাযোগ প্রযুক্তি নির্ভর করা।

ব্যবসা বানিজ্যঃদিন দিন প্রযুক্তি সহজতর করেছে জীবনের প্রতিটি কাজ। বিনোদন থেকে শুরু করে দাপ্রিক কোনো কাজই আর প্রযুক্তির বাইরে নয়। একই ভাবে বেশ কিছুদিন আগেই আমাদের ব্যবসায়-বাণিজ্যে যুক্ত হয়েছে এই আধুনিক মাধ্যমটি। ফলে দিন দিন বাড়ছে ই-বাণিজ্যের প্রসার। বিভিন্ন সীমাবদ্ধতা স্বত্বেও বাংলাদেশে ইতিমধ্যে কিছু ই-বাণিজ্য ওয়েবসাইট গড়ে উঠেছে। ই-বাণিজ্যকে কাজে লাগিয়ে বাংলাদেশ একদিকে যেমন ব্যবসা-বাণিজ্যের প্রভূত উন্নতি করা সম্ভব তেমনি একই সাথে কর্মসংস্থানের ক্ষেত্রেও যুক্ত হয়েছে অমিত সম্ভাবনা আর সমৃদ্ধির সুযোগ।

দেশের ব্যবসা-বাণিজ্যের আপডেট তথ্য ভিক্তিক ওয়েব পোটাল এড্রেস বাজার ডট কম্‌। তথ্য প্রযুক্তির যুগে মানুষের জীবন যাত্রার গতি আরো বাড়িয়ে দিতে এই ওয়েব পোর্টালে রয়েছে শ্রেণীবিন্যাস অনুসারে ব্যবসা-বানিজ্যের তথ্য। এখান হতে নিজস্ব সার্চ ব্যবস্থার মাধ্যমে যে কোন প্রতিষ্টানকে এক নিমিষেই খুজে পাওয়া যাবে।

ইলেকট্রনিক কমার্স কে সংক্ষেপে ই-কমার্স বলা হয়। এটি একটি আধুনিক ব্যবসা পদ্ধতি। ইন্টারনেটের মাধ্যমে এ ব্যবসা এবং লেনদেন পরিচালিত হয়ে থাকে। বস্তুত ইলেকট্রনিক কমার্স হচ্ছে ডিজিটাল ডাটা প্রসেসিং এবং ট্রান্সমিশনের মাধ্যমে কোন ব্যক্তি বা প্রতিষ্ঠানের ব্যবসা সংক্রান্ত আদান প্রদান। সাধারণত এ কাজটি সম্পাদন করা হয় সবার জন্য উন্মুক্ত একটি নেটওয়ার্ক তথা ইন্টারনেটের মাধ্যমে। তাই বলা যায় ইন্টারনেটের মাধ্যমে কোন ব্যক্তি বা প্রতিষ্ঠানের ব্যবসা সংক্রান্ত আদান প্রদান বা লেনদেন করার প্রক্রিয়াই হলো ই-কমার্স।

সংবাদঃ শতাব্দী ধরে মানুষের কাছে সংবাদ ও তথ্য সরবরাহ করার জন্য ছাপার মাধ্যম ব্যবহৃত হয়ে আসছে। সবচেয়ে প্রাচীন সংবাদপত্র হলো, রোমের ‘অ্যাক্টা দিউরনা’ (Acta Diurna), প্রকাশিত হয় ৫৯ খ্রীস্ট-পূর্বাব্দে। জনগণকে গুরুত্বপূর্ণ সামাজিক ও রাজনৈতিক ঘটনাবলী অবহিত করার জন্যে জুলিয়াস সিজার প্রধান শহরগুলোতে সংবাদ প্রেরণের ব্যবস্থা করতে চাইলেন। বিশাল সাদা বোর্ডের এই ‘অ্যাক্টা’ সরকারের স্ক্যানডালস, মিলিটারি ক্যামপেইন কিংবা বিচার ও মৃত্যুদণ্ডের সংবাদ লিখে প্রদর্শনের জন্য রাখা হতো বাথের মতো জনবহুল শহরগুলোতে। সর্বপ্রথম সংবাদপত্র প্রকাশিত হয় অষ্টম শতাব্দীর চীনে। হাতের লেখা সংবাদ-সম্বলিত কাগজ বিলি করা হতো বেইজিংয়ে ।

১৪৪৭ সালে জোহান গুটেনবার্গ ছাপাখানা আবিষ্কার করলে শুরু হয় সংবাদপত্রের আধুনিক যুগ। গুটেনবার্গের এই যন্ত্র, চিন্তার অবাধ আদান-প্রদান ও জ্ঞান বিস্তৃতিতে ভূমিকা রাখে যার ফলে ইউরোপীয় রেনেসাঁর বিষয়বস্তু সংজ্ঞায়িত করা সহজ হয়। এই সময়ে, নিউজলেটারগুলো উঠতি বণিকদেরকে ব্যবসার বিষয়সংক্রান্ত সংবাদ প্রদান করতো। পঞ্চদশ শতাব্দীর শেষের দিকে জার্মানের শহরগুলোতে সার্কুলেশন হতো ম্যানুসক্রিপ্ট নিউজশিটস্। এই প্যামফ্লেট বা সংবাদপুস্তিকা ছিলো দারুণ স্পর্শকাতরতায় পরিপূর্ণ। একটি রিপোর্টে বলা হয়েছিলো যে, জার্মানারা ট্র্যানসিলভ্যানিয়াতে ভ্লাদ সেপেড্রাকুলের ( Vlad TsepesDrakul) হাতে নিগৃহীত হচ্ছে যা কাউন্ট ড্রাকুলা হিসেবেও পরিচিত ছিলো। ১৫৫৬ সালে ভেনিস সরকার প্রকাশ করে ‘নোটিজি স্ক্রিটে’ ( Notizie Scritte) এর জন্য পাঠকদের মূল্য প্রদান করতে হতো ছোট একটি সিকি বা ‘গেজেট’ (gazetta)।

বর্তমানে! বর্তমানের সংবাদ ও সংবাদপত্র!! অনেক সহজলভ্য ও আধুনিক। আজকে, রেডিও, টেলিভিশন, ও ইন্টারনেটের যুগেও প্রিন্ট মিডিয়ার গুরুত্ব কোনো অংশেই কম নয় বলে আমার দৃঢ় বিশ্বাস। কাগজের পাতায় ছাপার অক্ষরে চিরস্থায়ী লেখাগুলোই হয়ে থাকবে, কালের সমুজ্জ্বল সাক্ষী।


র্ভাচুয়াল রিয়েলিটি (Virtual Reality)


সায়েন্সফিকশান গুােলাতে নানা রকম কল্পনার ফানুস ওড়ানো হয়ে থাকে। তবে র্ভাচুয়াল জগৎ এখন আর নিছক কল্পনার বস্তু নয়। ওয়েবে সেকেন্ড লাইফের সফলতা প্রমাণ করে দেয় র্ভাচুয়াল জগতে কত কি করা সম্ভব। র্ভাচুয়াল রিয়েলিটি শুধুমাত্র ভিডিও গেমস বা বিনোদনের কাজেই ব্যববহৃত হচ্ছে না। আমেরিকান সেনাবাহিনী এটির র্পূন ব্যবহার করছে তাদের সেনা সদস্যদের প্রশিক্ষনের কাজে বিমান ওড়ানো, প্যারা ট্রুপি থেকে শুরু করে ট্যাংক কামান নিয়ে যুদ্ধের ময়দানে যুদ্ধ করে বাস্তব যুদ্ধের কাছাকাছি অনুভূতি ও অভিজ্ঞতা অর্জনে র্ভাচুয়াল পরিবেশ কাজে লাগানো হচ্ছে।

অনলাইনে যুক্ত হওয়া মানে পৃথিবীর যেকোন প্রান্তের যেকোন ব্যক্তির সাথে যুক্ত হওয়ার সুবিধাপ্রাপ্ত হওয়া।এই বিষয়টাকে কাজে লাগিয়েই অনলাইন নির্ভর বিভিন্ন ভার্চুয়াল পরিবেশ নিয়ে কাজ করে যাচ্ছেন অনেক গবেষক। সম্প্রতি গুগলও lively নামে ভার্চুয়াল চ্যাটিং সার্ভিস চালু করেছে যেখানে একটি ভার্চুয়াল কক্ষ বা পরিবেশে আপনি বন্ধু-বান্ধব ও আতœীয়-স্বজদের নিয়ে প্রবেশ করতে পারবেন। সেখানে ইচ্ছেমত বস্তু দিয়ে সাজানো, বন্ধুদের সাথে মারামারি, নাচানাচি, আবেগের গ্রাফিক্যাল প্রকাশ ইত্যাদি সম্ভব।

সফটওয়ার জায়ান্ট মাইক্রোসফট সম্প্রতি দটি নতুন প্রযুক্তির জন্য পেটেন্ট আবেদন করেছে।পেটেন্ট আবেদন ভার্চুয়াল বস্তুকে বাস্তবে উপলব্ধি করা সম্ভব হবে এমন নতুন প্রযুক্তির কথা বলা হয়েছে। এর একটি হচ্ছে ভার্চুয়াল রিয়েলিটি গ্লাস ও অপরটি হচ্ছে গেমিং হেলমেট । অবশ্য ভার্চুয়াল রিয়েলিটি গ্লাসের প্রযুক্তিটি গুগল তৈরি করেছে বলে আগেই খবর চাউর হয়েছে। পিসি ম্যাগ এক খবরে জানিয়েছে , ভবিষ্যতের মোবাইল ডিভাইস ও গেম কনসোল এক্সবক্স ৩৬০-এর জন্য নতুন প্রযুক্তির গ্লাস ও হেলমেট তৈরি করবে মাইক্রোসফট।

মাইক্রোসফটের প্রথম পেপটেন্ট আবেদনটিতে এক ধরনের হেলমেটের কথা বলা হয়েছে , যাতে চোখের ওপর গ্লাস বসানো থাকবে। ফলে গেমার নিজেকে গেমের একজন চরিত্র হিসেবে ভাবতে পারবে। দ্বিতীয়টি হচ্ছে, সানগ্লাসের মতো চোখে পরার যন্ত্র। এ গ্লাস হবে স্বচ্ছ যা চোখে ডিসপ্লে হিসেবে ছবি , টেক্সট ও ভিডিও দেখাবে । মাইক্রোসফটের স্মাটফোন , মিডিয়া প্লেয়ার ও অন্যান্য মোবাইল ডিভাইসের মতোই এ গ্লাস বা হেলমেট কাজ করবে ও মাইক্রোসফটের অপারেটিং সিস্টেমে চলবে। প্রযুক্তিপণ্য ছাড়াও মাইক্রোসফটের এ ডিভাইসগুলো সাধারন হেলমেট বা সানগ্লাস হিসেবেও ব্যাবহার করা যাবে। ডিভাইসগুলোর প্রযুক্তি হিসেবে ভার্চুয়াল ইমেজ প্রজেক্টের ব্যবহৃত হবে যা লেজারের সাহায্যে ছবি দেখানোর বিষয়টি নিয়ন্ত্রণ করবে।

উল্লেখ্য মাইক্রোসফট ছাড়াও গুগল এমন প্রযুক্তি নিয়ে কাজ করছে। সম্প্রতি গুগল টার্মিনেটরের মতো দেখতে এইচইউডি গ্লাস তৈরি করছে বলেই খবর রটেছে। অ্যান্ড্রয়েড চালিত এ গ্লাস চোখের ক্ষেত্রে অ্যামোলিড ডিসপ্লে হিসেবে কাজ করবে।

অবশেষে আনুষ্ঠানিকভাবে ‘ভার্চুয়াল রিযেলিটি গ্লাস’ বিষয়ে তথ্য দিয়েছে গুগল। প্রযুক্তিবিশ্বে দীর্ঘদিন ধরেই গুজব চালু ছিল যে ‘ এক্স ল্যাব’ নামে গুগলের কথিত এক গোপন পরীক্ষাগারে তৈরি হচ্ছে গুগলের প্রযুক্তিনির্ভর চশমা ২০১১ সালের ডিসেম্বর মাসে এ গুজব ছড়িয়েছিল । গুগলের তৈরি এ চশমাটি খবই পাতল যা কপালের ওপর লাগিয়ে রাখতে হয়। এর ডার কোনায় বসানো রয়েছে ছোট একটি গ্লাস যার মাধ্যমে ব্যবহারকারীর কাছে তথ্য পৌছায় ।

গুগলের দেওয় ভিডিওতে গুগল গ্লাস পরিধানকারীকে দেখা যাচ্ছে । চশমাধারী তাঁর চোখের সামনে ফটে ওঠা অ্যাপ্লিকেশন কন্ঠস্বরের মাধ্যমে নিয়ন্ত্রণ করে ছবি তোলা, ভিডিও করা , আবহাওয়ার তথ্য জানার মত কাজগুলো করেছেন । প্রযুক্তি বিশ্লেষকেরা ধারণা করছেন, ম্মাটফোন ও ট্যাবলেটে গুগলের অ্যান্ড্রয়েড অপারেটিং সিস্টেম যেভাবে ব্যবহৃত হয় গুগল গ্লাসেও সেই একই অপারেটিং সিস্টেম ব্যবহৃত হয়েছে । সর্বাধুনিক প্রযুক্তির এ চশমা অনেকটাই ‘টার্মিনেটর’ ছবিতে দেখানো ডিসপ্লে অথবা গেমের হেড আপ ডিসপ্লের ( এইচইউডি) মতো।

প্রায় দুই বছর ধরে ‘গুগল গ্লাস ’ নামে একটি প্রকল্পের অধীনে এ গ্লাস তৈরির কাজ করেছে গুগল। আগেভাগেই এ গ্লাস সম্পর্কে জনগণের অভিমত জানতেই তথ্য প্রকাশ করা হয়েছে বলে গুগল কর্মকর্তারা জানিয়েছে। এ বছরই বাজারে আসবে গুগলের এ প্রযুক্তি চশমা। এর দাম হতে পারে ৫০০ ডলার। উল্লেখ্য , গুগলের এক্স ল্যাবে নতুন প্রযুক্তির রোবট ও স্পেস এলিভেটর তৈরির কাজ চলছে বলেও প্রযুক্তি বিশ্বে গুজব রয়েছে।


কৃত্রিম বুদ্ধিমত্তা (Artificial Intelligence)


কৃত্রিম বুদ্ধিমত্তার (Artificial Intelligence) জনক ব্রিটিশ গনিতবিদ অ্যালান টিউরিংও বুদ্ধিমত্তার সংজ্ঞা কি তা নিরুপণ করতে পারবেন বলে মনে করেননি, বা এ নিয়ে কারোর সাথে বিতর্কেও যেতে চাননি। বুদ্ধিমত্তা কাকে বলে, তা একটি বহুল বিতর্কিত বিষয়, সেটা টিউরিং সময়কালে তো বটেই, এমনকি বর্তমানেও বুদ্ধিমত্তাকে বৈজ্ঞানিকভাবে সংজ্ঞায়িত করা সম্ভব হয়নি। কিন্তু টিউরিং এর ধারণা ছিল, মানুষের মস্তিষ্কের অভ্যন্তরে ঠিক কি ঘটছে, তা মানুষ না জানলেও যন্ত্রের মাধ্যমে বুদ্ধিদীপ্ত কাজ করানো সম্ভব। তার এই ধারণার উপর ভিত্তি করেই ১৯৫০ সালের দিকে গড়ে উঠেছে কৃত্রিম বুদ্ধিমত্তা|
তিনি বুদ্ধিমত্তার সংজ্ঞা নিরূপনের ঝামেলায় না গিয়ে তিনি যন্ত্রের বুদ্ধিমত্তার অস্তিত্ব প্রমাণে সচেষ্ট হয়েছিলেন বিখ্যাত টিউরিং টেস্টের মাধ্যমে। এটি এমন একটি পরীক্ষা যাতে যন্ত্রঘটিত কাজ মানুষকে বিভ্রান্ত করে দেয়, কাজটি যন্ত্র করেছে নাকি মানুষ করেছে? এক্ষেত্রে একজন মানুষকে নিয়োজিত করা হয় কাজটির বিচারক হিসেবে, তাকে বলতে হবে, কাজটি কে করেছে। মানুষের বিবেচনায় যদি মনে হয় কাজটি যন্ত্র দ্বারা সম্পাদিত হয়েছে, তার অর্থ হল, যন্ত্রটির মানুষের অনুরূপ কাজ করার ক্ষমতা নেই, আর যন্ত্রের কাজ যদি মানুষকে এই অনুভূতি দেয়, যে কাজটি মানব দ্বারা সঙ্ঘটিত হলেও হতে পারে, সেক্ষেত্রে যন্ত্রটিকে মানুষের অনুরূপ বুদ্ধিমত্তার অধিকারী হিসেবে বিবেচনা করা যেতে। বর্তমান কালে যারা কম্পিউটার ব্যবহার করেছেন, তাদের মধ্যে অনেকে ELIZA প্রোগ্রামটির সাথে পরিচিত, যাতে কোন প্রশ্ন করলে, প্রোগ্রামটি আমাদের দৈনন্দিন কথোপকথনের মত পালটা প্রশ্ন করে বসে। আর্টিফিসিয়াল ইন্টিলিজেন্সি শব্দটির সম্ভব্য বাঙ্গলা হয় কৃত্রিম বুদ্ধিমত্তা কিন্তু তাতে নাম করনটি সার্থক হয় না | কৃত্রিম বুদ্ধিমত্তা শব্দটির মানে দাড়ায় “আসল নয় এমন বুদ্ধিমত্তা”| কিন্তু তার চেয়ে বানানো বুদ্ধিমত্তা শব্দটি অনেক বেশী গ্রহনযোগ্য। কিন্তু শব্দটা যতটা মানান সই শুনতে ততটা শ্রুতি মধুর নয়।
জনক ব্রিটিশ গনিতবিদ অ্যালান টিউরিংও বুদ্ধিমত্তার সংজ্ঞা কি তা নিরুপণ করতে পারবেন বলে মনে করেননি, বা এ নিয়ে কারোর সাথে বিতর্কেও যেতে চাননি। বুদ্ধিমত্তা কাকে বলে, তা একটি বহুল বিতর্কিত বিষয়, সেটা টিউরিং সময়কালে তো বটেই, এমনকি বর্তমানেও বুদ্ধিমত্তাকে বৈজ্ঞানিকভাবে সংজ্ঞায়িত করা সম্ভব হয়নি। কিন্তু টিউরিং এর ধারণা ছিল, মানুষের মস্তিষ্কের অভ্যন্তরে ঠিক কি ঘটছে, তা মানুষ না জানলেও যন্ত্রের মাধ্যমে বুদ্ধিদীপ্ত কাজ করানো সম্ভব। তার এই ধারণার উপর ভিত্তি করেই ১৯৫০ সালের দিকে গড়ে উঠেছে কৃত্রিম বুদ্ধিমত্তা|
তিনি বুদ্ধিমত্তার সংজ্ঞা নিরূপনের ঝামেলায় না গিয়ে তিনি যন্ত্রের বুদ্ধিমত্তার অস্তিত্ব প্রমাণে সচেষ্ট হয়েছিলেন বিখ্যাত টিউরিং টেস্টের মাধ্যমে। এটি এমন একটি পরীক্ষা যাতে যন্ত্রঘটিত কাজ মানুষকে বিভ্রান্ত করে দেয়, কাজটি যন্ত্র করেছে নাকি মানুষ করেছে? এক্ষেত্রে একজন মানুষকে নিয়োজিত করা হয় কাজটির বিচারক হিসেবে, তাকে বলতে হবে, কাজটি কে করেছে। মানুষের বিবেচনায় যদি মনে হয় কাজটি যন্ত্র দ্বারা সম্পাদিত হয়েছে, তার অর্থ হল, যন্ত্রটির মানুষের অনুরূপ কাজ করার ক্ষমতা নেই, আর যন্ত্রের কাজ যদি মানুষকে এই অনুভূতি দেয়, যে কাজটি মানব দ্বারা সঙ্ঘটিত হলেও হতে পারে, সেক্ষেত্রে যন্ত্রটিকে মানুষের অনুরূপ বুদ্ধিমত্তার অধিকারী হিসেবে বিবেচনা করা যেতে। বর্তমান কালে যারা কম্পিউটার ব্যবহার করেছেন, তাদের মধ্যে অনেকে ELIZA প্রোগ্রামটির সাথে পরিচিত, যাতে কোন প্রশ্ন করলে, প্রোগ্রামটি আমাদের দৈনন্দিন কথোপকথনের মত পালটা প্রশ্ন করে বসে। আর্টিফিসিয়াল ইন্টিলিজেন্সি শব্দটির সম্ভব্য বাঙ্গলা হয় কৃত্রিম বুদ্ধিমত্তা কিন্তু তাতে নাম করনটি সার্থক হয় না | কৃত্রিম বুদ্ধিমত্তা শব্দটির মানে দাড়ায় “আসল নয় এমন বুদ্ধিমত্তা”| কিন্তু তার চেয়ে বানানো বুদ্ধিমত্তা শব্দটি অনেক বেশী গ্রহনযোগ্য। কিন্তু শব্দটা যতটা মানান সই শুনতে ততটা শ্রুতি মধুর নয়।


ক্রায়োসার্জারি (Cryosurgery)


ক্রায়ো শব্দের অর্থ বরফশীতল। প্রায় শত বছর আগে থেকেই ত্বকের বিভিন্ন ক্ষতের চিকিrসায় এই পদ্ধতি প্রয়োগ করা হচ্ছে। ত্বকের ক্ষেত্রে খুবই কার্যকর হওয়ায় বর্তমানেও ত্বকের বিভিন্ন অসুস্থতা যেমন—তিল, আঁচিল, এ্যাকনি, মেছতা, বিভিন্ন ধরনের টিউমার ও ক্যানসার চিকিrসায় এই পদ্ধতি ব্যবহার করা হয়। এ ছাড়া পাইলস, মুখের ক্যানসার, প্রোস্টেট, যকৃত্ এবং কোনো কোনো হাড়ের ক্যানসার, রেটিনোব্লাসটোমা, জরায়ুর মুখের ক্যানসারসহ বিভিন্ন অঙ্গের চিকিrসায়I এই পদ্ধতি ব্যবহার করা হচ্ছে।

ক্রায়োপ্রোব পৌঁছাতে পারে শরীরের এমন সব অঙ্গের চিকিrসায় এই পদ্ধতিতে করা সম্ভব। তবে সাধারণত আঞ্চলিকভাবে সীমাবদ্ধ এবং এক সেন্টিমিটারের চাইতে বড় শক্ত টিউমারের ক্ষেত্রে এই পদ্ধতি বেশি কার্যকর হতে দেখা যায়। বয়স্ক অথবা যেসব রোগীর পক্ষে অপারেশন বা রেডিওথেরাপির ধকল সহ্য করা সম্ভব নয়, তাদের ক্ষেত্রে এবং কোনো কোনো অঙ্গের ক্যানসারের পূর্বাবস্থায় বিদ্যমান কোষকলা ধ্বংসের উদ্দেশ্যে (যেমন জরায়ুর মুখের ক্যানসার) এই থেরাপি প্রয়োগ করা হলেও বিস্তৃত ক্যানসারের চিকিrসায় এই পদ্ধতি তেমন কার্যকর হয় না।

বরফশীতল তাপমাত্রার কোষকলা ধ্বংস করার ক্ষমতাকে ক্রায়োসার্জারি পদ্ধতিতে কাজে লাগানো হয়। এ ক্ষেত্রে অত্যন্ত শীতল তাপমাত্রায় কোষকলার অভ্যন্তরে বলের আকৃতিবিশিষ্ট ছোট ছোট বরফের কৃস্টাল তৈরি হয়ে এগুলোকে ধ্বংস করে ফেলে। তবে অসুস্থ অঙ্গের কোষকলায় রক্ত সরবরাহকারী ধমনিগুলোকে হিমায়িত করে তুলতে পারলে চিকিrসা অধিক কার্যকর হয়ে ওঠে।


বায়োইনফরমেট্রিক্স (Bioinformatics)


জীববিজ্ঞানের সমস্যাগুলো যখন কম্পিউটেশনাল টেকনিক ব্যবহার করে সমাধান করা হয়, তখন সেটাকে বলা হয় বায়োইনফরমেটিকস| ইন্টারনেটে প্রচুর টুল পাওয়া যাবে বায়োইনফরমেটিকসের| তবে একটু গভীরে ঢুকতে গেলে বুঝতে হবে এলগরিদম, শিখতে হবে প্রোগ্রামিং| আর পাইথন তো নাসার বিজ্ঞানীদের ভাষা! সাঁতার শেখার সবচেয়ে ভালো পদ্ধতি হলো পানিতে লাফ দেয়া| আপনি যদি কম্পিউটার কিংবা জীববিজ্ঞান বিষয়ক কোন বিষয়ে আগ্রহী থাকেন, তাহলে বায়োইনফরমেটিকসের রাজ্যে উঁকি মারতে সমস্যা কি?

একজন নিউরোসায়েন্টিস্টের কথা শোনা যাক: Learn how to do your own data analysis. Know statistics well. Know at least some basic programming/scripting in Python, R, Matlab, etc. This will be of immense value in helping you get your research done efficiently and correctly, without needing to rely on other people’s code (and time and commitment). This will become more important as our field becomes more data driven.

বায়োইনফরমেটিকসের একটা চ্যালেঞ্জ হচ্ছে এটা ইন্টারডিসিপ্লিনারি একটা বিভাগ। তারমানে আপনাকে জানতে হবে:

  • অবশ্যই জীববিজ্ঞান
  • এলগরিদম বুঝতে হবে অন্তত
  • গণিত
  • ডাটা আছে পরিসংখ্যান থাকবে না!
  • প্রোগ্রামিং
  • অপারেটিং সিস্টেম

তার মানে এই না এই সব বিষয়ে আপনি ‘বস’ হবেন। আসলে আপনি বস হবেন হয়তো একটা কি দুইটা বিষয়ে। তবে বাকি বিষয়গুলোতে একটা সাধারণ ধারণা অবশ্যই রাখতে হবে। ‘কাট-এজ’ বিষয়গুলোর এইটাই হলো সমস্যা। একটা বাস্তব উদাহরণ দেই, ঢাবি-তে একটা বায়োইনফরমেটিকসের চলমান প্রজেক্টে মেশিন-লার্নিঙের এলগরিদম ব্যবহার করা হচ্ছে। সেই এলগরিদম হলো সাপোর্ট-ভেক্টর-মেশিন, যেটা দিয়ে কিনা আর্টিফিশিয়াল ইন্টেলিজেন্স/রোবোটিকসের কাজ করা হয়!

আজকে আমরা পাইথন দিয়ে শুরু করি। আপনার পূর্বে পাইথনে কোডিঙের অভিজ্ঞতা না থাকলেও চলবে।পাইথন ২.৭ নামিয়ে নিন এখনই। তারপর IDLE খুলে প্রোগ্রাম লেখা শুরু করুন|

আমাদের ডিএনএর সিকোয়েন্স মাত্র চারটা অক্ষর দিয়ে লেখা হয়: A, T, G, C| মনে করুন আপনার হাতে একটা সিকোয়েন্স এসে পড়েছে:

ATGCACAGTGTCGCGCATATA

ডিএনএ সিকোয়েন্সের একটা ধর্ম হলো এর GC-content| কোন সিকোয়েন্সের মধ্যে কত শতাংশ GC আছে তার উপর নির্ভর করে ওই সিকোয়েন্সটা সম্পর্কে একটা ধারণা লাভ করা যায়। GC-content বের করার সূত্র হলো

GC-content = (G count + C count )/ base count) * 100

তাহলে চলুন প্রোগ্রাম লিখি। আমরা আপাতত পাইথন শেলে কাজ করবো। শেলের সুবিধা হলো এখানে সাথে সাথে কোন কমান্ডের ফলাফল দেখা যায়। তাই কোড টেস্ট করা, শেখার জন্য জিনিসটা ভালো অনেক।


বায়োমেট্রিক্স (Biometrics)


বায়োমেট্রিক্স মানুষের বৈশিষ্ট্য দ্বারা মানুষের পরিচয় উল্লেখ করে| বায়োমেট্রিক্স চিহ্নিতকরণ এবং এর একটি ফর্ম হিসাবে ব্যবহার করা হয় কম্পিউটার বিজ্ঞান প্রবেশাধিকার নিয়ন্ত্রণ| এটি অধীনস্ত যে কোন দলের মধ্যে ব্যক্তি চিহ্নিত করতে ব্যবহার করা হয় নজরদারি|

বায়োমেট্রিক অভিন্ন পরিচয় ব্যক্তি লেবেল এবং বর্ণনা করতে ব্যবহৃত স্বাতন্ত্র্যসূচক, পরিমাপযোগ্য হিসেবে ব্যবহৃত হয়। বায়োমেট্রিক অভিন্ন পরিচয় প্রায়ই শারীরিক বনাম আচরণগত বৈশিষ্ট্য হিসেবে শ্রেণীকরণ করা হয়। একটি শারীরবৃত্তীয় বায়োমেট্রিক Iris স্ক্যান, DNA বা ফিঙ্গারপ্রিন্ট দ্বারা সনাক্ত করা হবে। ব্যবহারিক বায়োমেট্রিক্স এর সাথে সম্পর্কিত করা হয় সহ একজন ব্যক্তি, আচরণ কিন্তু সীমাবদ্ধ রাখে না: টাইপ তাল, চলাফেরার ভঙ্গি, এবং ভয়েস।কিছু গবেষক বায়োমেট্রিক্স এর আধুনিক বর্গ শব্দটি behaviometrics উদ্ভাবন করেছেন|

প্রবেশাধিকার নিয়ন্ত্রণ অধিক প্রথাগত উপায়ে যেমন একটি হিসাবে টোকেন ভিত্তিক সনাক্তকরণ সিস্টেম, অন্তর্ভুক্ত ড্রাইভারের লাইসেন্স যেমন একটি অথবা পাসপোর্ট, এবং জ্ঞান ভিত্তিক সনাক্তকরণ সিস্টেম, পাসওয়ার্ড বা ব্যক্তিগত পরিচিতি সংখ্যা | বায়োমেট্রিক অভিন্ন পরিচয় ব্যক্তিকে অনন্য যেহেতু তারা টোকেনটি ও পদ্ধতি জ্ঞান ভিত্তিক আর পরিচয় যাচাই করার মধ্যে অধিক নির্ভরযোগ্য, যাইহোক, বায়োমেট্রিক অভিন্ন পরিচয় সংগ্রহের এই তথ্য চরম ব্যবহার সম্পর্কে গোপনীয়তা উদ্বেগ উত্থাপন|


জেনেটিক ইঞ্জিনিয়ারিং (Genetic Engineering)


বিজ্ঞান চর্চার প্রাথমিক যুগের সূচনাঘটেছিল গণিত চর্চার মধ্য দিয়ে। মধ্যযুগে তা পদার্থবিদ্যার বিকাশে যুগান্তকারী ভূমিকা রাখে। ধীরে ধীরে নিউটন, গ্যালিলিও, আইনস্টাইন, বোরের তত্ত্ব একে আধুনিক যুগে নিয়ে আসে। কিন্তু, 1920 এর আবিষ্কারের ধারা কিছুটা স্তিমিত হয়ে পড়ে। তখন, বিজ্ঞানীরা ঝুকতে থাকে পরিবেশ, পৃথিবী, মানুষ, জীবজগৎ নিয়ে গবেষণার দিকে। বর্তমানে একবিংশ শতাব্দীকে তাইনিঃসন্দেহে বলা হচ্ছে The Century of Biological Science. এর কারণ 1972 সালে পল বার্গের রিকম্বিনেন্ট ডিএনএ টেকনোলজি বা জেনেটিক ইঞ্জিনিয়ারিং এরআবিষ্কার।

প্রাণ রসায়ণের সবচেয়ে আধুনিক এ শাখায় জীবনকে সংজ্ঞায়িত করা হয় অণু-পরমাণু পর্যায়ে, একে বলা হয় “The Molecular Logic Of Life”। A-T-C-G এই মাত্র চারটি হরফে লেখা এ বিষয়কে বলা হয় Language of GOD. জেনেটিক ইঞ্জিনিয়ারিং মূলত ট্রান্সজেনিক (উন্নত বৈশিষ্টধারী) উদ্ভিদ ও প্রাণী সৃষ্টিতে কাজ করে। নামের শেষে ইঞ্জিনিয়ারিং যোগ করার কারণ হচ্ছে, জীববিজ্ঞানের কেবলমাত্র এ শাখাটিতেই নিজের ইচ্ছামত ডিজাইন করে একটি প্রাণী সৃষ্টি করা যায়, ডিজাইন করা যায় নিজের পছন্দের ই.কোলাই যে কিনা নিজের কথামত উঠবে বসবে। কাজটা অনেকটা একটা কম্পউটার প্রোগ্রাম ডিজাইন করারমত, যা তোমার আদেশ সম্পূর্ণ মেনে চলে। চিন্তা করে দেখ, ব্যাপারটা একজন আবিষ্কারকের জন্য কতটা রোমাঞ্চকর যখনসম্পূর্ণ জীবন্ত কিছু একটা নিজের ডিজাইন মত কাজ করছে?

খুব গুরুত্বপূর্ণ ব্যাপার হচ্ছে, বিশ্বের অধিকাংশ দেশেই এ বিষয়টির সাথে জুড়ে দেয়া হয় বায়োটেকনোলজিকে। ­ জেনেটিক ইঞ্জিনিয়ারিং এর একটি ক্ষুদ্র অংশ। বায়োটেকনলজির অন্যান্য শাখা গুলো হল মাইক্রোবায়োলজি, ­বায়োকেমিস্ট্রি, ­ বায়োস্ট্যাটিসটি ­ক, ইমিউনোলজি, ওর্গানিক কেমিস্ট্রি, এনজাইমোলজি, ইনসিলিকো (কম্পিউটেশনাল)বায়োলজি, টিস্যু কালচার ইত্যাদি। ঢাকা বিশ্ববিদ্যালয়ের ­ এ বিভাগটিতে জেনেটিক ইঞ্জিনিয়ারিং এর সাথে সাথে এ সবগুলো বিষয়ই প্রথম থেকেই পড়ানো হয়। একারণেই একজন জেনেটিক ইঞ্জিনিয়ায় একজন মাইক্রোবায়োলজিস ­্ট কারণ, নিজের ব্যাকটেরিয়াগুলো ­ তাকে পেটরি ডিসে জন্মাতে হয়; সে একজন বায়োকেমিস্ট কারণনিজের সৃষ্টি জীব থেকে সংগৃহীত প্রোটিন তাকে বিশ্লেষণ করতে হয়; সে একজন পরিসংখ্যানবিদ কারণ 3.2 বিলিয়ন বেস পেয়ারের মাঝে তাকে ধারণা করে কাজ করতে হয়; সে একজন অর্গানিক কেমিস্ট কারণ নিজের আবিষ্কৃত ওষুধের মলিকিউলার গঠন তাকে বের করতে হয় এবং পরিশেষে একজন কম্পিউটার প্রকৌশলী কারণ বিশাল ডিএনএ এনালাইসিসের জন্য তাকে সফট ওয়ার ডিজাইন করতে হয়। এ সবই শিখানো হয়ে কার্জন হলের পাশে সাদা বিল্ডিংটার ৬ তলায়। তুমি সত্যিই হয়ে উঠবে “Jack of all traits, master of SOME”.


ন্যানো টেকনোলোজি (Nano Technology)


ন্যানো টেকনোলজিকে বলা হচ্ছে প্রকৃত অর্থেই বিজ্ঞান আবিষ্কৃত ‘আলাদিনের চেরাগ’ মারত্মক সব ঘটনা ঘটাতে সক্ষম হবে এই প্রযুক্তি। যদিও এর পক্ষে বিপক্ষে নানান সব যুক্তি ও আছে। তারপরও ন্যানো টেকনোলজি এর পজেটিভ দিকগুলোই বেশী বলে মনে হয় এবং এ ক্ষেত্রে বাংলাদেশের রয়েছে অপার সম্ভাবনা।

আজকে একটি সুখবর দেই। ফিফা (FIFA) তে বিশ্ব ফুটবলে বাংলাদেশের অবস্থান ১৬৯ তম হলেও ইরানের তথ্যভান্ডার স্টেট ন্যানো তে দেখলাম ২০১২ সনে এই ন্যানো টেকনোলজির ক্ষেত্রে বাংলাদেশের স্থান ৬২ তম। এই তালিকা তৈরি করা হয়েছে Web of Science (ISI Web Knowledge) এ প্রকাশিত গবেষণা প্রবন্ধের উপর ভিত্তি করে। অনেক ভালো খবর তাই না? ২০১২ সালের Web of Science (ISI Web Knowledge) এ বাংলাদেশ থেকে বা বাংলাদেশী সম্মানিত বিজ্ঞানী/লেখকদের প্রাকাশিত ১২০১টি প্রবন্ধের মধ্যে ৬৭টি লেখা হয়েছে ন্যানো টেকনোলজি নিয়ে।

তবে মজার বিষয়টি অন্য জায়গায়। আমাদের বিশ্ববিদ্যালয়ের ক্ষেত্রে আমরা বাংলাদেশী হিসাবে গবেষণা প্রবন্ধ প্রকাশ করলেও তা বিশ্ববিদ্যালয় তথা অন্য দেশের নামে তালিকাভূক্ত হবে। আমার জানা ভূল থাকতে পারে তবে আমার জানামতে Web of Science (ISI Web Knowledge) এর রেংকিং হয়। সে হিসাবে আমার বিশ্বাস বাংলাদেশের স্থান অনেক উপরেই হবে কেননা রেংকিং এ ক্ষেত্রে আমাদের গবেষণার সুফল ভোগ করছে অন্য দেশ।

তিনি কথা বলেছিলেন সকল ধরনের প্রযুক্তির পেছনের কথা নিয়ে, সে সবের ভালে-মন্দ থেকে কতটা লাভ হয়েছে মানব জাতির, না থাকলে কি হতো? উনি উদাহরণ দিয়েছেন দ্রুতগামী বিমানের কথা যেটার বাজেট কয়েক মিলিয়ন ডলার, সরকারী খরচে এ ধরনের বিমানের মেকিং কতটা জরুরী, যেখানে সমাজের ৫% মানুষ এ ধরনের বিমানে ভ্রমণ করার মত যোগ্যতা বা প্রয়োজনীয়তা অনুভব করেন। আগে পরে অনেক যুক্তি দেখিয়েছিলেন তিনি। চাইলে ইউটিউব থেকে দেখে নিতে পারেন। নীল পোষ্টম্যান বিশ্বব্যাক্তিত্ব হিসেবে প্রশ্ন করেছেন সবার কাছে, যে কোন নতুন প্রযুক্তির (নিউক্লিয়ার প্ল্যান্টের কথা ভাবতে পারেন, ভাবতে পারেন মোবাইলে কথা, ভারতে পারেন দ্রুতগামী জেট বিমানের কথা, হতে পারে ইন্টারনেট) আবিষ্কারের সময় এ কথাগুলো ভাবার জন্য, লাভ ক্ষতির হিসেবটা কষে নেয়ার জন্য, একটু ভাবার জন্য।


সমাজ জীবনে তথ্য ও প্রযুক্তিন প্রভাব


আমরা অনেক শুনেছি প্রতিবাদ, আন্দোলনে ইন্টারনেট এর প্রভাব নিয়ে। আমরা শুনেছি তথ্য বিপ্লবের কথা এবং তা কিভাবে চীন, রাশিয়া, সোভিয়েত ইউনিয়নের কিংবা ইরানের মত দেশ গুলোতে ছড়িয়ে পড়ে।
ধরে নেয়া হতো আসলে ইন্টারনেট খুবই চকৎকার একটি প্রযুক্তি যখন এটি ব্যবহার হয় গনতন্ত্র প্রচারে। তখনি আসেন Cyber utopianism এর ভাবধারায় বিশ্বাসী লোকজন। Cyber utopianism হলো তারা যারা সচেতন ইন্টারনেট স্বাধীনতার অন্ধকার দিক টা নিয়ে সচেতন। তারা বিশ্বাস করত ইন্টারনেট এর দ্রুত তথ্য প্রবাহ সমাজকে পরিবর্তন করবে এবং তা ভাল হবে। তাদের এই একজন গর্ডন ব্রাউন বলেন- এতে তথ্য প্রবাহ হবে দ্রুত এবং মানুষের কাছে যাবে। এবং জনগন নিজস্ব মতামত তৈরি করবে। ধারণা করা হয় ব্লগ বা সামাজিক ওয়েবসাইট গুলো আগেকার দিনে ফ্যাক্স এর দ্রুততম মাধ্যম হিসেবে কাজ করবে।
কাজ প্রযুক্তির এই যুগে মানুষ যেমন তার জীবনযাত্রায় অভাবনীয় পরিবর্তন আনতে সক্ষম হয়েছে তেমন এর অপব্যবহারের ফলও কিন্তু কম নয়। এমন একটি নমুনা হল অনলাইনে প্রতারণা ও এর মাধ্যমে হয়রানির শিকার। সামাজিক যোগাযোগের মাধ্যম ফেসবুক এখন প্রায় সকলের কাছে জনপ্রিয়। ফেসবুকের মাধ্যমে উঠতি বয়সের কিশোর-তরুণরা নানা অপরাধেও জড়িয়ে যাচ্ছে। অধিকাংশ ক্ষেত্রে নারীরাই এর শিকার হচ্ছে। ভাবছেন এর কি কোন প্রতিকার নেই।  হ্যাঁ আছে।
তথ্য ও প্রযুক্তি আইন, ২০০৬ এর ৫৭ (১) ধারাতে বলা হয়েছে যদি কোনো ব্যক্তি ইচ্ছাকৃতভাবে ওয়েবসাইটে বা অন্য কোন ইলেক্ট্রনিক বিন্যাসে এমন কিছু প্রকাশ বা সম্প্রচার করে যা মিথ্যা ও অশ্লীল যার দ্বারা কারো মানহানি ঘটে বা ভাবমূর্তি ক্ষুন্ন হয় আর এ ধরনের তথ্যগুলোর মাধ্যমে সংশ্লিষ্ট ব্যক্তির বিরুদ্ধে উসকানি প্রদান করা হলে অনধিক ১০ বছর কারদন্ড এবং অনধিক এক কোটি টাকা অর্থদণ্ডে দণ্ডিত হওয়ার বিধান আছে।
আবার পর্নোগ্রাফি  আইন ২০১২ এ আছে, কোন ব্যক্তি ইন্টারনেট বা ওয়েবসাইট বা মোবাইল ফোন বা অন্য কোন ইলেকট্রনিক ডিভাইসের মাধ্যমে পর্নোগ্রাফি সরবরাহ করলে তিনি এ ধরণের অপরাধের জন্য সর্বোচ্চ ৫ (পাঁচ) বৎসর পর্যন্ত সশ্রম কারাদণ্ড এবং ২০০০০০ (দুই লক্ষ) টাকা পর্যন্ত অর্থদণ্ডে দণ্ডিত হবেন।
আবার অনেকে এইসব আইন সম্পের্কে জানিনা বা জেনেও আইনের আশ্রয় নেই না বলে এসব অপরাধ ও অপরাধীকে দমানো কঠিন হচ্ছে।
বর্তমানে আমাদের দৈনন্দিন জীবন ওতোপ্রতোভাবে জড়িত মিডিয়া ও প্রযুক্তির  সঙ্গে, আর সেই মাধ্যমগুলো হচ্ছে সংবাদপত্র, টেলিভিশন, রেডিও, মোবাইল, কম্পিউটার-ল্যাপ্টপ, ইন্টারনেট সহ আরো উন্নত প্রযুক্তি।
বিশ্ব এখন আমাদের হাতের মুঠোয়। মুর্হুতের মধ্যেই ছড়িয়ে পড়ছে বিশ্বের যেকোন প্রান্তের যেকোন খবর। ইন্টারনেট  হলো এমন একটি মাধ্যম যার সাহায্যে জানা জাচ্ছে যে কোন দেশের রাজনীতি, অর্থনীতি, ইতিহাস, দর্শন, ভৌগলিক অবস্থান, সংস্কৃতি, আর্থ-সামাজিক অবস্থান, দৈনন্দিন চলমান সংবাদ সম্পর্কে সম্যক ধারনা।
বাংলাদেশের প্রেক্ষাপটে মিডিয়া ও প্রযুক্তির মূল ব্যবহারকারী হচ্ছে এদেশের তরুন সমাজ। এটা অবশ্যই অনেক ভাল দিক যে, আমাদের দেশের তরুন-তরুনীরা বিশ্বের সাথে তাল মিলাচ্ছে। কিন্তু কথা হচ্ছে মিডিয়া ও প্রযুক্তির ব্যবহারে আমাদের তরুন-তরুনীরা কতটুকু সচেতন?
আমি একটা কথাই বলতে চাই শিক্ষিত ও সচেতন তরুন সমাজ অবশ্যই মিডিয়া ও প্রযুক্তির সুফল ভোগ করছে। শুধু মাত্র মিডিয়া ও প্রযুক্তিকে ব্যবহার করেই আমাদের শিক্ষিত তরুন সমাজ গড়ে তুলছে এক বিশাল কর্মক্ষেত্র। কিন্তু বর্তমানে শহুরে জীবন হতে শুরু করে মফস্বল ও গ্রামের অর্ধশিক্ষিত এবং অশিক্ষিত তরুনরাও খুব সহজেই পেয়ে যাচ্ছে তথ্য প্রযুক্তির ছোয়া। কিন্তু তাদের অনকেরই নেই সচেতনতা। তাইতো মিডিয়া ও প্রযুক্তির অপব্যবহারই হচ্ছে বেশি।
বেড়ে যাচ্ছে আত্মহত্যা,খুন, অপহরন ও ইভটিজিং সহ নানা ধরনের সামাজিক অপরাধ। আমাদের টিভি চ্যানেলগুলো সম্পূর্ণ ব্যবসায়িক মনভাবাপন্ন। বর্তমানে ব্যবসায়ীরা বাজার ধরার কৌশল হিসাবে বেছে নিচ্ছে মিডিয়াকে। বিজ্ঞাপন মিডিয়াকে পুরো পুরি গ্রাস করে ফেলেছে। আর বিজ্ঞাপনের মাধ্যমে নারী-পুরুষ সকলেই পন্যে পরিনত হচ্ছে। যেখানে সচেতনতার চেয়ে পুজি ও মুনাফাই প্রধান।
বিশ্বব্যাপি ইন্টারনেবট এর ব্যবহার প্রাচ্য দেশ গুলোতে ছড়িয়ে দেয়ার যৌক্তিকতা কিছুটা আর্থিক এবং সাময়িক ! ইন্টারনেট বিপলবের শুরুর দিকে প্রচার করা হয় এতে সবাই “connected” থাকবে ! বলা হত এতে গনতন্ত্র হবে অনিবার‌্য ! কিন্তু তার পেছনে অন্য রাজনৈতিক চাল ও ছিল ও বটে!কি রকম, দেখা যাক আমেরিকানরা এজন্য দ্রুত চীন, রাশিয়, ইরান  এর মত দেশ গুঃেলাকে টেকনোলজি ব্যবহার করতে দেয় এই বলে এতে গনতন্ত্র সুসম্মত হবে! তারপর আসল্যে আইপড এর উদারতা ! প্রাচ্যর রাজনৈতিক নীতি নির্ধারকরা বিশ্বাস করত যদি কারো কাছে আইপড, ল্যাপটপ এর মত জিনিস থাকবে তারা ধীরে ধীরে প্রাচ্য ভার ধারায় বিশ্বাসী হয়ে উঠবে। আমেরিকান লেখক , কলামিষ্ট থমাস ফ্রাইডমেন বলেন , “রাশিয়া, চীন, ইরানের মত দেশ গুলো দখল করার জন্য বোমা নয় আইপড ফেলো !!” এতে অতি সূক্ষভাবে মানুষের রাজনৈতিক, সামাজিক , এবং অর্থনৈতিক মানসিকতার পরিবর্তন হবে এবং তা আমেরিকার জন্য ভালো !এটি অনেকটা হিন্দি সিরিয়াল দেখতে দেখতে হিন্দিভাষী হয়ে উটার মত! ক্রমাগত ভাবে মানুষের মনোজগতে ভাষ্য পৌছে দেয়ার দ্বারা মানুষের ভিতর পরিবর্তন নিয়ে আসা! প্রাচ্যের প্রযুক্তি তাদের কে প্রাচ্য দেশগুলোর গোলামে পরিণত করবে! এতে ঐ সব দেশে নানা ধরনের গোলমাল তৈরি হবে নারী কিংবা খেটে খাওয়া মানুষের মাঝে!
কিছু রাজনৈতিক নেতা ইন্টারনেট প্রযুক্তিকে ভয় পান! এতে হয়তো জনগনের মত প্রকাশ দৃশ্যমান হয়ে পড়বে ! লিবিয়ান প্রেসিডেন্ট গাদ্দাফি অন্যতম ! কিছু চাইনিজ ব্লগার সবার আগে ব্লগিং এর দ্বারা সরকারের সমালোচনা শুরু করে! কিছু দেশে সরকার এতে বাধা তৈরী করে !  উদাহরণ স্বরুপ থাইল্যান্ড এ ২০০৮ সালে ২৪ ঘন্টার বন্ধ করে দেয়া হয় প্রায় ৩০০০ ওয়েরসাইট! ফেসবুক , টুইটার দ্রুত মানুষের ধারণা পরিবর্তনে সাহায্য করছে! নিঃসন্দেহে যুর সমাজে সামাজিক পরিবর্তনের বাহক !
ভাবার সময় এসে পড়েছে কিভাবে প্রযুক্তি সমাজে প্রভার বিস্তার করে । কিসে আমাদের জনৎ ভালো । সব প্রযুক্তি মানব কল্যানে তৈরী  ভাবলেও তা কিছূ টা রাজনৈতিক উদ্দেশ্যমূলক ও । যা আমরা খোলা চোখে ধরতে পারিনা। নিজস্ব সংস্কৃতি আর ইতিহাসের প্রতি সুমুন্নত থাকলেই কেবল সকল প্রকার প্রযুক্তির খারাপ দিক গুলো এড়িয়ে লাভটা আদায় করে নেয়া সম্বর।আমরা আসলে কতটা সচেতনস , জাতি হিসেবে , ব্যক্তি হিসেবে , সমাজ হিসেবে ।


তথ্য ও যোগাযোগ প্রযুক্তি ও অর্থনৈতিক উন্নয়ন


প্রযুক্তি মানুষকে পরিবর্তিত বিশ্বের চ্যালেঞ্জ মোকাবেলায় তথ্য-জ্ঞান-দক্ষতা-কৌশল-প্রবণতা এবং যন্ত্রপাতি সমৃদ্ধ করে তোলে কার্ল মার্কসের ভাষায়- ‘‘প্রযুক্তি হচ্ছে মানুষের প্রতিদিনের সাথী’’ মানুষ এই প্রযুক্তির সাথে প্রতিদিন অব্যাহতবাবে গায়ে গায়ে লেগে আছে। এ লেগে থাকা হয় জ্ঞান-দক্ষতা- বা শারীরিক আকারে চলতে পারা। সোজা সরল ও সংক্ষেপে বলা যায়-, প্রযুক্তি মানুষকে যোগায় জীবন সহায়ক ব্যবস্থা বা লাইফ সার্পোট সিস্টেম, যে কারনে মানুষ পৃথিবীতে নিজেকে খাপ খাইয়ে নেয়ার শক্তি অর্জন করে।
তথ্য প্রযুক্তির কল্যাণে মানুষের জীবন হয়েছে এখন অনেক সহজ, সরল এবং স্বাচ্ছন্দ্যময়। ঘরে বসে বিশ্ব ভ্রমণ, মার্কেটিং, ব্যাংকিং বিভিন্ন ধরনের সার্ভিস কিম্বা র্ভাচুয়াল ওয়ার্ল্ডে ঘোরা ঘুরি করা এখন একেবারে সহজ। তাইতো এখন মানুষের এমন কোন কাজ নেই যেখানে প্রযুক্তির ছোয়া লাগেনি।
একুশ শতকের চ্যালেঞ্জ মোকাবিলায় তথ্য ও যোগাযোগ প্রযুক্তি পৃথিবীর দরিদ্র জনগোষ্টির জন্য খুলে দিয়েছে অপার সম্ভাবনার দুয়ার। ইতহিাসের ধারাবাহিকতায় কৃষি বিপ্লব, শিল্প বিপ্লবের পর বর্তমান পৃথিবী নতুনতর এক বিপ্লবের মুখোমুখি হতে চলেছে যার নাম তথ্য বিপ্লব। একথা বলার অপেক্ষা রাখে না যদি এই শতাব্দীকে নতুন কোন নামে অভিহিত করা হয় তবে তথ্য প্রযুক্তির শতাব্দী হবে তার জন্য উপযুক্ত।
বর্তমান শতাব্দীর গ্লোবালাইজেশনের ফলে একটি দেশের উন্নয়ন এবং দারিদ্র্য বিমোচনের ক্ষেত্রে তথ্য এবং যোগাযোগ প্রযুক্তি অন্যতম নিয়ামকের ভূমিকা পালন করছে। তথ্য ও যোগাযোগ প্রযুক্তির হাতিয়ার হচ্ছে কম্পিউটার এবং ইন্টারনেট। কম্পিউটার এবং ইন্টারনেটের বদৗলতে পৃথিবী এখন গ্লোবাল ভিলেজে পরিণত হয়েছে। বলা চলে পৃথিবী হাতের মুঠোয় নয় আঙুলের ডগায় চলে এসেছে। কম্পিউটার প্রযক্তির ব্যাপক ব্যবহার এবং সফল প্রয়োগ যে কোন অনুন্নত দেশকে উন্নত করতে অগ্রণী ভূমিকা পালনে সচেষ্ট।
কম্পিউটার এমন এক ধরনের প্রযুক্তি যার মাধ্যমে শিক্ষা, চিকিৎসা, বিনোদন, অর্থনীতি, রাজনীতি, বিনিয়োগ, ব্যবসা-বাণিজ্য, পরিকল্পনা, গবেষণা, নিয়ন্ত্রণ, ডিজাইন ইত্যাদি বিষয়াবলীকে একটি প্রক্রিয়ার মাধ্যমে সংযুক্ত করা সম্ভব। আর এই তথ্য প্রবাহ একটি সম্বন্বিত সূত্রে গ্রথিত হয়ে পৃথিবীর সকজ জাতি, ধর্ম, বর্ণ-গোষ্ঠীর মানুষকে সম্বন্বিত তথ্য প্রবাহের সঙ্গে অবিরাম সংযুক্ত রাখতে সচেষ্ঠ। আমরা দেখেছি বিংশ শতাব্দীতে তথ্যের আদান প্রদান হয়েছে টেলিগ্রাফ, টেলিফোন, টেলিফ্যাক্স, টেলেক্স, পোষ্টাল, কুরিয়ার সার্ভিস ইত্যাদির মধ্যে দিয়ে, কিন্তু বর্তমানে বিশ্বব্যাপী যোগাযোগ ব্যবস্থার অভুতপূর্ব অগ্রগতি সাধিত হওয়ায় এখন আর এই সমস্ত মাধ্যম নতুন কিছু নয়। এখন প্রেরক প্রতিঠি ক্ষেত্রেই কত দ্রুত সুষ্ঠুভাবে প্রয়োজনীয় বার্তা প্রাপকের কাছে পৌঁছাতে পারবে এই ভাবনায় এখন উদ্ভাবকের বহুবিধ উদ্ভাবনের ভিত্তি হিসাবে কাজ করছে।
কম্পিউটার এবং স্যাটেলাইট প্রযুক্তিকে কাজে লাগিয়ে তথ্য আদান-প্রদানের ক্ষেত্রে যে পদ্ধতিটি অভূতপূর্ব, যুগান্তকারী, অকল্পনীয় ও অবিশ্বাস্য বিপ্লব সাধিত করেছে তার নাম ইন্টারনেট। আজকে বিশ্বের সমস্ত উন্নত এবং উন্নয়নশীল দেশ ইনফরমেশন সুপার হাইওয়ে বা তথ্যের মহাসড়কে প্রবেশ করে চলেছে। কম্পিউটার ভিত্তিক তথ্য বিনিময়ের অপূর্ব এই ব্যবস্থা গড়ে তুলেছে বিশ্বের তথ্য অবকাঠামো বা গ্লোবাল ইনফরমেশন ইনফ্রাষ্ট্রোকচার বা সংক্ষেপে জিআইআই। পৃথিবীর প্রায় সব ধরনের তথ্য ব্যবস্থা এই জিআইআই এর অর্ন্তভূক্ত হচ্ছে; তথ্যের এই মহা রাজপথে যার অবস্থান যত দূঢ় ঠিক সেই অনুপাতে তথ্য আর জ্ঞানের ভান্ডার চলে যাবে তার নিয়ন্ত্রণে, যা ছাড়া ভবিষ্যতে টিকে থাক যেন এক দু:সাধ্য ব্যাপার।


তথ্যই শক্তি


পৃথিবীতে বেঁচে থাকার স্বার্থে তথ্যের প্রয়োজন যার নিকট যত বেশী তথ্য রয়েছে সে তত বেশী শক্তিশালী। পরিবেশ, খাদ্য, জীবন-ব্যবস্থা, প্রতিবেশী, আবহাওয়া, কর্ম, সুযোগ, শিক্ষা, গবেষণা, প্রতিযোগি ইত্যাদি সম্পর্কে আমাদের তথ্য একান্ত পয়োজন যদি আমাদের কাছে তথ্য আসা বন্ধ হয়ে যায় তবে হয়তো আমাদের বেঁচে থাকা সম্ভব হবে না। বেঁচে থাকার তাগিদে প্রযুক্তি যে তথ্য সংগ্রহে সাহায্য করে তা নিসন্দেহে মূল্যবান, কারণ এক সময়ে বলা  হতো ‘জ্ঞানই শক্তি’ কিন্ত বর্তমানে বলা হয়  ‘তথ্যই শক্তি’। সম্প্রতি বাংলাদেশের উপকুলের উপর দিয়ে বয়ে যাওয়া প্রলয়ংকারী ঘূণিঝড় ‘সিডর’ এর আঘাতে লন্ড ভন্ড হয়ে গেছে সমগ্র উপকুল কিন্তু ৯১ এর জলোচ্ছাসের চেয়ে প্রাণহানি ঘটেছে তুলনামূলক কম এর একটি মাত্র কারণ আর তা হলো যথা সময়ে জনগনের নিকট পর্যাপ্ত তথ্য প্রবাহ। সভ্যতার বিনাশে বা সভ্যতার বিকাশের ক্ষেত্রে তথ্য একজটি গুরুত্বপূর্ণ ভূমিকা রাখে আর সেই কারনেই তথ্য আমাদের সকলের প্রয়োজন, প্রয়োজন  তথ্যের মহাসড়কে প্রবেশ করা। আর তথ্যের মহাসড়কে ইন্টারনেট একত্রিত করে চলেছে- টেলিফোন, কনফারেন্সিং, সরাসরি বিপিনণ, শিক্ষা, গবেষণা, অফিস ব্যবস্থাপনা, টিভি সম্প্রচার, প্রতিরক্ষা ইত্যাদিকে, যার মাধ্যমেআপনি আপনার প্রয়োজনীয় তথ্যটি সংগ্রহ করতে পারেন।

অতিদ্রুত প্রায় নিখরচায় ঘরে বসেই মূহুর্তের মধ্যেই বিশ্বের একপ্রান্ত থেকে অন্য প্রান্তে বিভিন্ন ব্যক্তিগণ বসে ইন্টারনেটের মাধ্যমে জরুরী মিটিং সম্পন্ন করতে পারেন। আপনি একজন আইনবিদ আদালতে বসে মামলা নিয়ে সমস্যায় ভুগছেন অথবা আপনি একজন ডাক্তার রোগীর রোগ নির্ণয়ে মাথা ঘামাচ্ছেন এসব সমস্যার সমাধান দিতে পারে ইন্টারনেট। আপনি আপনার সমস্যা প্রয়োজনীয় ঠিকানায় মেইল করে জেনে নিতে পারেন। ঘরে বসেই বিখ্যাত সব লাইব্রেরীর ক্যাটালগ খুজে দেখতে পারেন, জেনে নিতে পারেন আপনার প্রয়োজনীয় উপরকণটি সেখানে আছে কিনা। আমেরিকার লাইব্রেরী অব কংগ্রেস তৈরি করেছে ‘‘ লাইব্রেরী অব কংগ্রেস মার্ভেল: সক্ষেপে এলসি মার্ভেল যার মাধ্যমে খুজে দেখতে পারেন তাদের সংগৃহিত দলিলপত্র। এমন আরো অনেক তথ্যের ভান্ডার রয়েছে ইন্টারনেটের ইনফরমেশন সুপার হাইওয়েতে যেমন ঘরে বসে একজন সাহিত্য রসিক ডুবে যেতে পারেন আয়ারল্যান্ডের সাহিত্যের আর্কাইভের ‘কিউরিয়াতে’, পেতে পারেন একজন স্থপত্য শিল্পী ভেনিসের স্থাপত্য বিশ্ববিদ্যালয়ে প্রবেশাধিকার। এসব বিষয়ে আগ্রহ না থাকলে নিছক ব্যক্তিগত সখের খবর জেনে নিতে পারেন। হয়তোবা অনীল ও নীলার ভালবাসা বিনিময়ের মতো আপনার জীবনেও ঘটতে পারে অনুরূপ ঘটনা। এক সময়ে বলা হতো কম্পিউটার এল অনেজের চাকুরীর চলে যাবে, বেকারত্ব বাড়বে কিন্তু বাস্তবে কথাটির সম্পূন্ন বিপরীত ঘটতে চলেছে, কম্পিউটারই দিতে পারে লক্ষ লক্ষ বেকার যুবক-যুবতীদের কর্মের সংস্থান।
দেশে এবং বিদেশে আইসিটি প্রফেশনালদের চাহিদা অনেক বেশী। ২০১০ সালের মধ্যে বিশ্বে প্রায় ৩ মিলিয়ন আইটি পেশাজীবির প্রয়োজন। শুধুমাত্র ভারতেই প্রয়োজন হবে ৫ লাখ আইটি প্রফেশনালে (ন্যাসকমের স্্যাডি অনুযায়ী)। বাংলাদেশে যদি ৩ মিলিয়নের মধ্যে ৫০০০০ আইটি প্রফেশনাল সরবরাহ করতে পারে তাহলে দেশের বর্তমান রেমিটেন্স দ্বিগুন করা সম্ভব।


আউটসোসিং


বর্তমান বিশ্বাংনে সারা পৃথিবী জুড়ে চলছে আইসিটির আউটসোসিংয়ের জোয়ার। আইসিটির উন্নয়নের ধারাকে অব্যহত রাখতে জন্ম নিযেছে নতুনতর এক অর্থনীতি যার নাম জ্ঞান ভিত্তিক অর্থনীতি বা নলেজ ইকোনোমি। জ্ঞান ভিত্তিক অর্থনীতি বিকাশের সাথে সাথে আমেরিকা, ইউরোপ কিংবা বিশ্বের উন্নত দেশ গুলোতে প্রয়োজন দেখা দিচ্ছে বিপুল পরিমান তথ্য প্রসেসিং বা প্রক্রিয়াকরণের। যার ফলশ্র“তিতে উন্নয়নশীল দেশ সমূহ আইসিটি এনাবল্ড সার্ভিসেস কে কাজে লাগিয়ে অর্জন করছে বিপুল পরিমান বৈদেশিক মুদ্রাশুধু বৈদেশিক মুদ্রা অর্জন নয় এর ফলে কর্মসংস্থান সৃষ্টি হচ্ছে দেশের বিপুল সংখ্যাক প্রশিক্ষিত বেকার দক্ষ জনগোষ্ঠীর।

কম্পিউটার জগত আগষ্ট ২০০৬ সালের সংখ্যায় প্রকাশিত একটি রিপোর্টে দেখা যায়, ‘‘বাংলাদেশের বার্ষিক আয়ের সবচেয়ে বড় অংশটি আসে পোশাক শিল্প থেকে যার পরিমান প্রায় ৩৫০০ কোটি টাকা। অন্য দিকে বিশ্বের হেলথকেয়ার ইনফরমেটিক্সের (প্রটাকল ডিজাইনিং, ডাটাবেজ তৈরী, টেলিমেডিসিন, টার্মিনোলজি ম্যানেজমেন্ট, কম্পিউটিং মেডিসিন এবং মেডিক্যাল ট্রান্সক্রিপশন) প্রায় ২০ লাখ কোটি টাকার বাজার। এর যদি ২০ শতাংশের ছোট একটা অংশ ও মেডিক্যাল ট্রান্সক্রিপশনের হয়, তাহলে এর বাজার প্রায় ১ লাখ কোটি টাকা আর আমরা যদি সেই এক লাখ কোটি টাকার ২০ ভাগের একটা ক্ষুদ্র অংশও প্রতিযোগিতা করে নিতে পারি তবে এর পরিমান দাঁড়াবে   ৫ হাজার কোটি টাকা।

আউটসোসিং- এ বাংলাদেশের সম্ভাবনার কারন হিসাবে যে বিষয়গুলি দেখা যায় তা হলো-

ভৌগলিক ভাবে বাংলাদেশ এবং দক্ষিন এশিয়াস্থ দেশ গুলো ১২ ঘন্টা টাইম জোন এ অর্ন্তভূক্ত  এর ফলে যখন যুক্তরাষ্ট্র বা ইউরোপে রাত্রি তখন বাংলাদেশে দিন যার ফলে প্রায় ২৪ ঘন্টাই কাজ করার সুবিধা পাচ্ছে বাংলাদেশ।

আমাদের রয়েছে বিপুল সংখ্যাক প্রশিক্ষিত ত্যথ প্রযুক্তিবিদ এবং ইংরেজি ভাষা জানা এক ঝাঁক উদ্দমী তরুন যারা ক্রমর্বধনশীল চাহিদার সাথে নিজেদের খাপ খাইয়ে নিতে সক্ষম।
বিশ্বের মধ্যে বাংলাদশের শ্রমের বাজার মূল্য অত্যন্ত কম। এখানকার শিক্ষিত বেকার জন শক্তি স্বল্প বেতনে উন্নত মানের সেবা প্রদান করতে সক্ষম। এক্ষেত্রে মেয়েরা ছেলেদের চেয়ে ভাল করতে পারে। যার প্রকৃষ্ঠ উদাহরণ আমাদের গার্মেন্টস শিল্প।

সাধারণত একটি ইন্ড্রাষ্ট্রি গড়তে যে পরিমানে বৈদেশিক বিনিয়োগের প্রয়োজন রয়েছে, আইসিটি এনাবল্ড সার্ভিসের যে কোন একটি সেক্টরে এর বিনিয়োগের পরিমান চার ভাগের এক ভাগ লাগবে। যদি প্রয়োজনীয় অবকাঠামো ও স্থিতিশীল কর্ম পরিবেশ গড়ে তোলা যায় তাহলে আউটসোসিংয়ের বিশাল বাজার আধিপত্য বিস্তার করতে তেমন সমস্যা হবে না।


অবাধ তথ্য প্রবাহের গুরুত্ব


আর্থ-সামাজিক উন্নয়ন তথা দারিদ্র বিমোচনের ক্ষেত্রে অবাধ তথ্য প্রবাহের গুরুত্ব অপরিসীম। কারণ, যে চীনে কমুইনিষ্ট শাসকরা বছরের পর বছর ধরে পাশ্চাত্যে মন্দ ও খারাপ জিনিস গুলো নিজস্ব সংস্কৃতিতে প্রবেশ করতে পারে এই দোহাই দিয়ে অবাধ তথ্য আদান-প্রদান বন্ধ

প্রদান বন্ধ রেখেছিল তারাই আবার জনগনের অবাধ তথ্য আদান –প্রদান উম্মুক্ত করে দিল এর কারণ তারা সর্বাধুনিক কলা কৌশল এবং বাজারের অবস্থার সঙ্গে তাল মিলিয়ে চলতে চাচ্ছে। বেইজিং ওর্য়াল্ড ব্যাংক অফিসের একজন ইনফরমেশন টেকনোলজি স্পেশালিষ্ট বলেছেন যে, ‘‘ব্যবসায়ীরা জানে যত তাড়াতাড়ি তারা বির্হিবিশ্বের সাথে যোগাযোগ স্থাপন করতো তারাই ইন্টারনেটের মাধ্যমে উম্মক্তকরে দিয়েছে চায়নাকে। আর জাপানের কথাতো বলার অপেক্ষা রাখে না কেননা জাপান আজ রীতিমত পশ্চিম ইউরোপ এবং আমেরিকার মাথা ব্যাথার কারণ হয়ে দাড়িয়েছে। অন্যদিকে এই প্রযুক্তি ব্যবহারে নতুন নতুন শক্তি হিসাবে অর্বিভূত হয়েছে দক্ষিণ কোরিয়া, তাইওয়ান, সিঙ্গাপুর, থাইল্যান্ড, মালয়েশিয়া, ইন্দোনেশিয়া, চীন এবং ভার। এদের পদাংখ অনুসরণ করে শ্রীলংকা, পারিকস্তান, ফিলিপাইন এবং ভিয়েতনাম এগিয়ে চলেছে। শুধু পিছিয়ে রয়েছি আমরা। তথ্য পাচার হওয়ার অজুহাত দেখিয়ে বাংলাদেশকে প্রায় দুই যুগ পিছনে ঠেলে দেয়া হয়েছে তবে আশার কথা বহু চড়াই উত্তরাই পেরিয়ে ২০০৬ ইং সালের ২১ মে বাংলাদেশ সাবমেরিন কেবলের মাধ্যমে ইনফরমেশন সুপার হাইওয়ের সঙ্গে যুক্ত হওয়ার সৌভাগ্য অর্জন করেছে। কিন্তু দুঃখের বিষয় সাবমেরিন ক্যাবলের যথাযথ ব্যবহার নিশ্চিত করা এখন সম্ভবপর হয় নাই।


ডিজিটাল ডিভাইড


জালের ন্যায় পরস্পর সর্ম্পকযুক্ত থাকা গ্রামের সহজ সরল মানুষ গুলোকে বাদ দিয়ে বাংলাদেশের উন্নয়ন সম্ভব নয়। ৫৫ হাজার ৫৯৮বর্গ মাইলের এই দেশের বর্তমান জনসংখ্যা প্রায় ১৫ কোটি। যার ৭৬ ভাগ মানুষ বাস করে গ্রামে। বাকী ২৪ ভাগ মানুষ  বাস করে শহরে। যারা শহরে বাস করে তারা উন্নত নাগরিক সুবিধা ভোগ করে আর গ্রামের মানুষ সর্বদা সেই সুযোগ-সুবিধা থেকে বঞ্চিত। শহুরে মানুষ গুলো বিজ্ঞান ও প্রযুক্তির উন্নত ছোঁয়া পেয়ে অভ্যস্ত অন্যদিকে গ্রামের সাধারন মানুষ গুলো দেখাতো দুরের কথা সে প্রযুক্তি গুলির নাম ও শুনেনি। বর্তমান ডিজিটাল ডিভাইডের কারনে গ্রাম ও শহর দুইটি আলাদা সত্তা হিসাবে প্রকাশ পাচ্ছে। কিন্তু একটি কথা পরিষ্কার আর তা হলো গ্রামকে বাদ দিয়ে একটি দেশের দারিদ্র বিমোচন তথা উন্ন্য়ন সম্ভব নয়।
গ্রাম এবং শহর, ধনী এবং দরিদ্রের মধ্যে এই যে বৈষম্য এর হাত থেকে মুক্তির একটিই পথ আর তা হলো সর্বদা তথ্য ও যোগাযোগ প্রযুক্তির (আইসিটি) ব্যাপক ব্যবহার এবং সফল প্রয়োগ।
বর্তমানে একটি কথা প্রচলিত রয়েছে আইসিটি শুধু আধুনিক ব্যবসা বাণিজ্যের ক্ষেত্রে কাজে লাগে। এই ধারনার সাথে আমি একমত নই কারন আধুনিক ব্যবসা বাণিজ্যের ক্ষেত্র হচ্ছে শহর। অন্যদিকে ৭৬ শতাংশ কৃষিজীবি মানুষ বাস করে গ্রামে, গ্রামের এই দ্ররিদ্র কৃষক, জেলে, কামার-কুমারের ভাগ্যের উন্নয়ন না ঘটাতে পারলে দেশের দারিদ্র বিমোচন করা সম্ভব নয়। ত্য ও যোগাযোগের অবাবে আমাদের মতো দেশে প্রায় দেখা যায়, কোন অঞ্চলে কাঁচামাল রয়েছে, কি ধরনের বিনিয়োগ পরিবেশ, বাজারে কোন ধরনের পণ্যের চাহিদা ইত্যাদি। যদি আইসিটি ব্যবহারের মাধ্যমে অবাধ তথ্য প্রবাহ নিশ্চিত করা যায় তাহলে একজন বিনিয়োগকারী সবগুলো তথ্য যাচাই বাছাই করে সিদ্ধান্ত নিতে পারবে। প্রান্তিক কৃষকরা মধ্যস্বত্বভোগীদের কবলে পড়বে না ফলে কৃষকরা পূর্বের তুলনায় অনেক বেশী লাভবান হতে পারবে। ফলশ্র“তিতে দেশের আর্থ-সামাজিক অবস্থার উন্নয়ন ঘটবে গ্রামীন জনগোষ্টীর দারিদ্যের বোঝা লাঘব হবে। কৃষি খাতের সার্বিক উৎপাদনশীলতা বাড়াতে এবং খাদ্য ব্যবস্থাকে গতিশীল করতে ই-সেবা কার্যকরী ভূমিকা রাখতে পারে। যা উৎপন্ন কৃষি পন্যের বাজার দর সম্পর্কে সংশ্লিষ্ট কৃষকদের অবহিত করার লক্ষে ওয়েবসাইট চালু হলেও তথ্য ও প্রযুক্তিগত পয়োজনীয় অবকাঠোমো ও ওয়েবসাইট থেকে তথ্য আহরণ বিষয়ক প্রয়োজনীয় জ্ঞানের অভাবে কৃষকরা তাদের উদ্দেশ্য পরিচালিত এই ওয়েব সাইট হতে কোন তথ্য পাওয়া হতে বঞ্চিত হচ্ছে। এক্ষেত্রে অবাধ তথ্য প্রবাহ নিশ্চিত করতে হবে। তবেই দারিদ্র বিমোচন তথা দেশের আর্থ-সামাজিক উন্নয়ন ঘটানো সম্ভব।

দারিদ্রতার কারণ
উন্নয়নশীল বাংলাদেশে প্রায় ৪০% মানুষ দারিদ্র সীমার নীচে বাস করে। দারিদ্র সমস্যার অনেক গুলি কারণ রয়েছে তার মধ্যে নিম্নলিখিত কারনগুলি অন্যতম।
১. সম্পদ ও সুযোগ সুবিধার অসম বন্টন।
২.অসম ও বিকৃত বাজার ব্যবস্থা।
৩. পরিবেশ দূষণ ও তার ক্ষয়।
৪. জবাবদিহিমূলক গণতন্ত্র ও সুশাসনের বিকাশ না হওয়া।
৫. অশিক্ষা ও অন্ধ শিক্ষা।
৬. অত্যাধুনিক প্রযুক্তি প্রয়োগ অদক্ষতা বা অনীহা।
৭. ক্রমবর্ধমান জনসংখ্যা।
৮. প্রাকৃতিক সম্পদের অভাব।
৯.প্রাকৃতিক দূর্যোগ ইত্যাদি।
উপরোক্ত কারনগুলির ফলে দরিদ্রের সৃষ্টি হচ্ছে ফলে সমাজে দেখা দিচ্ছে ধনী ও দরিদ্র দুইটি শ্রেণি। আর এই শ্রেণি বৈষম্যের ফলে কেউ আইসিটি ব্যবহারের সুযোগ পাচ্ছে আর কেউ সুযোগ পাচ্ছে না। এক্ষেত্রে আইসিটি দিয়ে উন্নয়ন আনয়নে দক্ষ কম্পিউটার প্রশিক্ষিত মানব সম্পদ তৈরির বিকল্প নেই।

ওর্য়াল্ড সামিট অন ইনফরমেশন সোসাইটির জেনেভা ঘোষণা পত্র
ওর্য়াল্ড সামিট অন ইনফরমেশন সোসাইটি জেনেভা ঘোষণা পত্র আইসিটিকে দারিদ্য বিমোচনের হাতিয়ার হিসাবে ব্যবহারের ঘোষণা দেয়া হয়েছে। ঘোষণ পত্রের মূলনীতেতে নিম্নলিখিত ঘোষণা প্রদান করা হয়েছে।
১.আইসিটিঅবকাটামো গড়ে তোলা।
২. সবার জন্য তথ্য প্রাপ্তি নিশ্চিত করা।
৩. দক্ষতা বৃদ্ধি।
৪. সহায়ক পরিবেশ তৈরি।
৫. জীবনের সকল ক্ষেত্রে আইসিটির ব্যবহার নিশ্চিত করা।
৬. সকল সাংস্কৃতিক ঐতিহ্য অক্ষুন্ন রেখে মাতৃভাষায় আইসিটি ব্যবহার নিশ্চিত করা।
৭. মত প্রকাশ এবং সংবাদ মাধ্যমের স্বাধীনতা নিশ্চিত করা।
৮. ত্যথ সমাজ গড়ার ক্ষেত্রে আর্ন্তজাতিক ও আঞ্চলিক সহযোগিতা নিশ্চিত করা।


ই-গর্ভনেস


একটি দেশের সরকার সে দেশের জনগনের জীবন যাত্রার মান উন্নয়ােন সদা সচেষ্ট। কিন্তু জনগনের সাথে সরাসরি ইন্টারএ্যাকশান না তাকার ফলে দ্রুত সিদ্ধান্ত গ্রহণ ও তা বাস্তবায়ন করা সম্ভবপর হয়ে উঠে না। যদি গ্রাম ও শহর অঞ্চলের মধ্যে যোগাযোগ স্থাপন করা যায় তাহলে তা দেশের মানুষের জীবন যাত্রার মান উন্নয়নে সহায়ক হবে। সরকারের কাজের গতি বাড়াবে, আমলাতান্ত্রিক জটিলতা হ্রাস পাবে। অবাধ তথ্য প্রবাহ, স্বচ্ছতা এবং জবাবদিহিতা নিশ্চিত করা সহজ হবে। আর এই কাজটি তখনই সম্ভব হবে যখন ই-গর্ভনেস বা ইলেকট্রনিক সরকার ব্যবস্থা প্রচলিত হবে।
ভারতের অন্ধ প্রদেশের মূথ্যমন্ত্রী (ল্যাপটপ মিনিষ্টার) চন্দ্রবাবু নাইডু ই-গর্ভানেস বা ইলেকট্রনিক সরকার ব্যবস্থা কে  (ঝরসঢ়ষব, গড়ৎধষ, অপপড়ঁহঃধনষব, জবংঢ়ড়হংরাব ধহফ ঞৎধংঢ়ধৎবহঃ) সরকার ব্যবস্থা বলে আখ্যায়িত করেন। তিনি বলেন, কিচু দরর্দশী রাজনৈতিক নেতার নেতৃত্বে কম্পিউটার ও ইন্টারনেট বির্ণর এক ধরনের সহজ, নৈতিকতাপূর্ণ জবাবদিহিতাপূর্ণ, দায়িত্বশীল, স্বচ্ছ সরকার ব্যবস্থায় হচ্ছে ই-গর্ভামেন্ট বা ইলেকট্রনিক সরকার। ই-র্গভমেন্ট ব্যবস্থা চালু হলে দেশের জনগন এবং সরকার যে সুবিধা গুলো প্রাপ্ত হবে তা নিম্নরূপ:
অনলাইনে সরকারের সমস্ত নীতিমালা, গেজেট, প্রস্তাবিত নীতিমালা বা আইনের খসড়া, পরিকল্পনা, বাজেট প্রভৃৃতি সাধারন জনসাধারনের জন্য উম্মক্ত করে দিলে প্রয়োজনে দেশের নাগরিকরা তাদের মতামত সংশ্লিষ্ট মন্ত্রী, প্রধানমন্ত্রী বা রাষ্ট্রপতির নিকট জানাতে পারবে। ফলে সরকারে কাজের স্বচ্ছতা ও জবাবদিহিতা নিশ্চিত করা সহজ হবে।
আইসিটির ব্যবহার নিশ্চিত  করা সম্ভবহলে আমলাতন্ত্র মুক্ত দক্ষ প্রশাসন ব্যবস্থা চালু করা সম্ভব হবে। কারন কম্পিউটার এবং তথ্য প্রযুক্তিতে দক্ষপ্রশিক্ষিত জনবলের কারনে প্রশাসন হয়ে উঠবে গতিশীল চাওয়া মাত্রই যে কোন তথ্য পাওয়া সম্ভব হবে ফলে লাল ফিতার দৌরত্মা কমে যাবে। অনলাইনে টেন্ডার, নিয়োগ বিজ্ঞপ্তি ইত্যাদি প্রকাশ করার ফলে সন্ত্রাসী কার্যক্রম কমে যাবে। সব কিছু যেহেতু অটোমেশনের মাধ্যমে হতে সেহেতু দূর্নীতি অনেকটা কমে যাবে।
ই-পুলিশিং ব্যবস্থা চালু করা সম্ভব হলে প্রতিটি পুলিশ ষ্টেশনকে একটি সমন্বিত নেটওর্য়াকের আওতায় আনতে পারলে দেশের প্রতিদিনের আইন শৃংখলা মনিটরিং করা সহজ হবে। জিডি ও এজহার এন্ট্রি, মামলা নিম্পত্তির ব্যাপারে কম্পিউটারে রের্কড থাকার ফলে আদালত যে কোন সময় মামলা সংক্রান্ত ত্যথাদি প্রাপ্ত হবেন যার ফলে মামলা গুলোর দ্রুত নিস্পত্তি করা সহজ হবে। অন্যদিকে মামলার ফাইল হারানো ভয় থাকবে না। দেশের শতকরা ৮০ ভাগ মামলায় যেহেতু ভুমি সংক্রান্ত সেহেতু ভুমি প্রশাসনে কম্পিউটারায়নে দূর্নীতি অনেক হ্রাস পাবে। অন্যদিকে নাগরিক সেবা প্রাপ্তি সহজতর হবে। ই-হেলথ বাস্তবায়ন করা সম্ভব হলে দেশের নাগরিক অতি দ্রুত এবং গ্রামের প্রত্যন্ত অঞ্চলে থেকেও বিশেষজ্ঞ ডাক্তারের নিকট থেকে চিকিৎসা সেবা পেতে পারেন। ই-লানিং বাস্তবায়ন করা সম্ভব হলে যে কেউ ঘরে বসেই ডিগ্রী অর্জন করতে পারবে।
ই-কর্মাস ও এম কমার্সের মাধ্যমে শেয়ার বাজার থেকে শুরু করে যে কোন ধরনের নিত্য প্রয়োজনীয় জিনিস পত্রাদী এর মাধ্যমে ক্রয় করা সম্ভব হবে। এক্ষেত্রে ক্রেডিট কার্ড ব্যবহার করা হবে। প্রতারিত ক্রেতা কেউ কনজিউমার রাইটসের আওতায় সাজা দেয়া সম্ভব হবে। অনলাইন ব্যাংকি এর মাধ্যামে ২৪ঘন্টায় নাগরিক সেবা পেতে পারে। এছাড়া সরকারী সব ধরনের কর, বিল, ইউটিলিটি বিল প্রভৃতি পরিশোধের ব্যবস্থা থাকবে। ন্যাশনাল ডাটাবেজ তৈরি করা সম্ভব হলে প্রতিটি নাগরিকের ব্যক্তিগত প্রোফাইল ও মানব উন্নয়ন সূচকসমূহ স্থান পাবে। ফলে এ ডাটাবেজ একই সাথে নাগরিক পরিচয় পত্র সনাক্তকরনের মাধ্যম ও জাতীয় মানব সম্পদ সংক্রান্ত তথ্যের উৎস হিসাবে কাজ করবে।  যে কোন নাগরিক অন লাইনে মতামত করতে পারবে।
এছাড়া একজন নাগরিক খুব সহজেই অনলাইনের মাধ্যমে জন্ম মৃত্যু রেজিষ্ট্রশন করণ, পাসর্পোট, ড্রাইভিং লাইসেন্স বিবাহ রেজিষ্ট্রেশন, সরকারী ফর্ম সংক্রান্ত ত্যথাদী পুরন এবং বিভিন্ন তথ্য খুব সহজেই প্রাপ্ত হবেন। ইলেকট্রনিক শাসন ব্যবস্থা প্রর্বতনে আশাবাদী ভারতের সাবেক রাষ্ট্রপতি এপিজে আব্দুল কালাম বলেন-‘‘আমি এমন একটি নির্বাচনী দৃশ্যপঠ কল্পনা করছি’’ যেখানে একটি নির্দিষ্ট আসন থেকে একজন প্রার্থী তার মনোনয়ন ফাইল করবেন। প্রায় সঙ্গে সঙ্গেই সংশ্লিষ্ট নির্বাচনী কর্মকর্তা জাতীয় নাগরিক আইডি ডেটাবেজ থেকে প্রার্থীর যাবতীয় ত্যত যাচাই করে নেবেন। এ তথ্য নেটওর্য়াক প্রয়োজনীয় সব খাত থেকেই তথ্যের প্রবাহ অবারিত থাকবে।
যেমন তার শিক্ষাগত যোগ্যতা তথ্য আসবে বিশ্ববিদ্যালয় বা সংশ্লিষ্ট থেকে। তার কর্মস্থলের রের্কড আসবে তিনি যেখানে কাজ করতেন সেখান থেকে। আয়কর ও অন্যান্য সূত্র যোগান দিবে তার সহায় সম্পদের বৃত্তান্ত। তার ঋণের ইতিহাসের নাড়ি নক্ষত্রের চিত্র তুলে ধরবে ব্যাংকের মতো বিভিন্ন আর্থিক প্রতিষ্ঠান। পুলিশের রের্কড থেকে আসবে তার নাগরিক সচেতনতা ও আচরণের ফিরিস্তি। তার ইনগত সংশ্লিষ্টতা সরবরাহ করবে বিচার বিভাগ। একজন প্রার্থীর এতসব রকমের কম্পিউটার টার্মিনালে স্বয়ংক্রিয়ভাবে কয়েক সেকেন্ডের মধ্যে পৌঁছাবে। এ সবই সম্ভব হবে ই-র্গভনেন্স এর জন্য বিশেষবাবে উদ্ভাবিত সফটওয়্যারের কেরামতিতে। সুতরাং এসব তথ্য যোগানের ক্ষেত্র কোন প্রকারের পক্ষপাতিত্ব কিম্বা দীর্ঘসূত্রতার বালাই থাকবে না। কৃত্রিম গোয়েন্দা সফটওয়্যার সংশ্লিষ্ট ব্যক্তির যাবতীয় তথ্যপ্ঞ্জু বিশ্লেষণ করে জানিয়ে দেবে ঐ প্রার্থী কতটা ও কিবাবে একজন সফল রাজনীতিক হিসাবে আর্বিভূত হবেন। কোন নির্বাচনী কর্মকর্তা গ্রামের প্রত্যন্ত অঞ্চলে বসে থেকেও মুহুতেই চূড়ান্ত সিদ্ধান্ত নিতে পারবেন। শুরু করতে পারবেন বাস্তব নির্বাচনী প্রক্রিয়া। ভোটারদের আর সশরীরে ভোটকেন্দ্রে এসে ভোট দিতে হবে না। বাড়িতেই থাকবেন এবং নিশ্চিন্তে ভারচুয়াল পুলিং বুথের মাধ্যমে ভোট দেবেন।